Mutagenetix > Incidental Mutation

Incidental Mutation 'R1473:Smchd1'

165965

Institutional Source

Beutler Lab

Gene Symbol

Smchd1

Ensembl Gene

ENSMUSG00000024054

Gene Name

SMC hinge domain containing 1

Synonyms

4931400A14Rik, MommeD1

MMRRC Submission

039526-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.769) question?

Stock #

R1473 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71344489-71475343 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 71361837 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121835 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000127430]

AlphaFold

Q6P5D8

Predicted Effect

probably benign
Transcript: ENSMUST00000127430

SMART Domains

Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054

Domain	Start	End	E-Value	Type
Pfam:HATPase_c_3	139	299	6.8e-16	PFAM
low complexity region	451	457	N/A	INTRINSIC
internal_repeat_1	859	1087	9.1e-5	PROSPERO
low complexity region	1185	1196	N/A	INTRINSIC
internal_repeat_1	1205	1409	9.1e-5	PROSPERO
coiled coil region	1649	1680	N/A	INTRINSIC
SMC_hinge	1721	1848	1.64e-15	SMART
low complexity region	1940	1954	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147111

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180743

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182107

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191623

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

98% (88/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	T	C	19: 57,068,236	D342G	probably damaging	Het
Acad8	T	C	9: 26,979,041	T293A	probably benign	Het
Adamts13	C	A	2: 26,981,753	Y310*	probably null	Het
Adcy6	T	A	15: 98,592,743	Y1102F	probably damaging	Het
Ahctf1	G	A	1: 179,776,108	T791M	probably benign	Het
Ahctf1	A	G	1: 179,799,279	V18A	probably damaging	Het
Ampd3	T	G	7: 110,804,935	S564R	probably damaging	Het
Anapc1	A	T	2: 128,617,697	I1814K	possibly damaging	Het
Arl4c	A	T	1: 88,701,609	L19Q	probably damaging	Het
Atp6v0e2	T	C	6: 48,539,264	Y49H	probably damaging	Het
Ccdc24	G	T	4: 117,869,904		probably benign	Het
Clcn6	A	C	4: 148,024,156	F139V	possibly damaging	Het
Col2a1	A	G	15: 97,982,908		probably benign	Het
Crip2	T	A	12: 113,143,500	C29S	probably damaging	Het
Cyp2a4	A	C	7: 26,314,763	N455T	probably benign	Het
Dhcr7	A	G	7: 143,841,368	D113G	probably damaging	Het
Dhcr7	T	C	7: 143,847,068	Y323H	probably damaging	Het
Dnah7a	A	C	1: 53,496,014	S2696A	probably benign	Het
Dnajc12	A	G	10: 63,397,244	T55A	probably benign	Het
Drosha	G	A	15: 12,912,520	E1075K	probably benign	Het
Duox2	A	G	2: 122,287,121	S911P	possibly damaging	Het
Ephb2	G	A	4: 136,694,058	A327V	possibly damaging	Het
Espl1	C	T	15: 102,320,443	T1711I	possibly damaging	Het
Fmnl2	A	G	2: 52,858,207	K22R	possibly damaging	Het
Fzd6	T	C	15: 39,030,963	F175L	probably damaging	Het
Gm4737	T	A	16: 46,154,819	E65V	probably damaging	Het
Gm5155	A	G	7: 17,905,091		noncoding transcript	Het
Gm6526	A	G	14: 43,748,846	I76M	probably damaging	Het
Gm6583	T	C	5: 112,354,549	T430A	probably benign	Het
Gm9881	A	T	16: 91,170,735	F34I	unknown	Het
Gm9892	T	C	8: 52,196,614	D148G	possibly damaging	Het
Grb10	C	T	11: 11,934,249	V486I	probably damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Hdac4	T	C	1: 92,029,968	H108R	possibly damaging	Het
Hist2h2bb	G	T	3: 96,270,072	L107F	probably damaging	Het
Hmcn1	G	A	1: 150,772,552	T661I	probably benign	Het
Icam1	T	A	9: 21,027,876	I515N	probably damaging	Het
Ifi208	A	G	1: 173,695,654	R497G	possibly damaging	Het
Igsf10	A	T	3: 59,318,767	V2495E	probably damaging	Het
Iqgap1	T	C	7: 80,734,011	M1102V	probably benign	Het
Itgb4	A	T	11: 115,984,047	N410I	probably benign	Het
Jup	T	C	11: 100,379,601	H360R	possibly damaging	Het
Kif20b	T	A	19: 34,974,496	S1685T	possibly damaging	Het
Lins1	T	C	7: 66,712,046		probably null	Het
Lrig1	T	A	6: 94,607,313	T917S	probably benign	Het
Mast2	A	G	4: 116,311,955	S814P	probably damaging	Het
Mast4	T	C	13: 102,772,519	T483A	probably damaging	Het
Mcpt1	T	C	14: 56,019,533	M176T	probably benign	Het
Mettl22	A	G	16: 8,473,961	Q38R	probably damaging	Het
Mrm2	T	C	5: 140,328,688	T131A	probably benign	Het
Nde1	T	G	16: 14,185,864	F71V	probably benign	Het
Nxn	C	T	11: 76,263,187	G274D	possibly damaging	Het
Olfr1230	A	T	2: 89,296,906	Y121*	probably null	Het
Olfr183	A	T	16: 58,999,912	T76S	probably benign	Het
Olfr414	T	A	1: 174,430,643	W72R	probably damaging	Het
Olfr427	G	T	1: 174,099,749	C97F	probably damaging	Het
Osbp2	T	C	11: 3,717,175		probably null	Het
Otud7a	C	A	7: 63,754,629		probably benign	Het
Phf3	G	A	1: 30,805,940	L1313F	probably damaging	Het
Pkhd1	A	T	1: 20,522,983	D1635E	probably benign	Het
Plpp1	A	G	13: 112,859,664	H171R	probably damaging	Het
Pofut1	A	G	2: 153,261,246	M172V	probably damaging	Het
Prmt5	A	G	14: 54,508,915	F580L	probably damaging	Het
Rab11fip3	A	T	17: 25,991,322	L987Q	probably damaging	Het
Retnlb	T	A	16: 48,818,665	C76*	probably null	Het
Rnf38	T	C	4: 44,131,584	N399S	probably benign	Het
Sbk1	A	G	7: 126,292,252	E286G	possibly damaging	Het
Scin	T	A	12: 40,077,502	T430S	probably benign	Het
Sgsm1	T	A	5: 113,263,257	T868S	probably benign	Het
Sipa1l1	G	A	12: 82,341,111	R37H	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Soga1	A	T	2: 157,020,448	Y1520*	probably null	Het
Stk32c	C	T	7: 139,125,179	R23Q	probably damaging	Het
Sult1d1	A	G	5: 87,564,739	M82T	probably benign	Het
Tat	T	C	8: 109,996,918	L346P	probably damaging	Het
Tenm3	C	A	8: 48,310,625	G789V	probably damaging	Het
Thsd7a	C	T	6: 12,338,622	S1203N	probably benign	Het
Tmem191c	G	A	16: 17,277,962		probably null	Het
Tmem268	A	G	4: 63,580,338	T239A	probably damaging	Het
Tmem82	A	C	4: 141,616,278	L227R	possibly damaging	Het
Ttn	A	T	2: 76,727,032	I29906N	probably damaging	Het
Txndc15	T	C	13: 55,721,574		probably benign	Het
Ubqln4	A	G	3: 88,565,845	I536V	probably benign	Het
Unc80	C	T	1: 66,521,581	H823Y	possibly damaging	Het
Vmn2r102	A	T	17: 19,694,581	I803F	probably benign	Het
Vmn2r6	G	T	3: 64,538,158	Y715*	probably null	Het
Vmn2r74	A	T	7: 85,961,410	C25S	probably damaging	Het
Wdr38	A	G	2: 39,000,979	T261A	probably benign	Het
Zfp653	T	C	9: 22,058,220	E250G	possibly damaging	Het

Other mutations in Smchd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Smchd1	APN	17	71465673	splice site	probably benign
IGL00529:Smchd1	APN	17	71394799	missense	probably benign	0.30
IGL00642:Smchd1	APN	17	71390432	missense	probably damaging	1.00
IGL00821:Smchd1	APN	17	71398623	missense	possibly damaging	0.92
IGL01330:Smchd1	APN	17	71436788	missense	probably benign
IGL01432:Smchd1	APN	17	71431290	missense	probably damaging	1.00
IGL01473:Smchd1	APN	17	71389750	missense	probably benign	0.00
IGL01705:Smchd1	APN	17	71381398	missense	probably damaging	1.00
IGL01787:Smchd1	APN	17	71391418	missense	probably damaging	0.99
IGL01814:Smchd1	APN	17	71378187	missense	probably benign	0.01
IGL01976:Smchd1	APN	17	71394725	nonsense	probably null
IGL01995:Smchd1	APN	17	71444020	missense	probably damaging	0.98
IGL02090:Smchd1	APN	17	71431253	missense	possibly damaging	0.86
IGL02302:Smchd1	APN	17	71358133	splice site	probably benign
IGL02309:Smchd1	APN	17	71443903	missense	probably benign	0.32
IGL02391:Smchd1	APN	17	71431259	missense	probably null	1.00
IGL02515:Smchd1	APN	17	71440957	missense	probably damaging	1.00
IGL02644:Smchd1	APN	17	71360021	splice site	probably benign
IGL03081:Smchd1	APN	17	71360191	missense	probably damaging	0.98
IGL03212:Smchd1	APN	17	71443891	missense	probably damaging	0.99
IGL03236:Smchd1	APN	17	71391430	missense	possibly damaging	0.88
IGL03297:Smchd1	APN	17	71349700	missense	probably benign	0.01
Dry_tortugas	UTSW	17	71440956	missense	probably damaging	1.00
R0049:Smchd1	UTSW	17	71431236	missense	probably benign	0.01
R0254:Smchd1	UTSW	17	71411891	missense	probably benign	0.00
R0391:Smchd1	UTSW	17	71403154	missense	probably damaging	1.00
R0403:Smchd1	UTSW	17	71394902	missense	probably damaging	1.00
R0499:Smchd1	UTSW	17	71387088	missense	probably benign
R0520:Smchd1	UTSW	17	71429543	missense	possibly damaging	0.85
R0616:Smchd1	UTSW	17	71379574	missense	probably benign	0.39
R1120:Smchd1	UTSW	17	71358146	nonsense	probably null
R1469:Smchd1	UTSW	17	71349730	missense	probably damaging	1.00
R1469:Smchd1	UTSW	17	71349730	missense	probably damaging	1.00
R1484:Smchd1	UTSW	17	71378257	missense	probably benign	0.31
R1501:Smchd1	UTSW	17	71365094	missense	possibly damaging	0.54
R1718:Smchd1	UTSW	17	71448833	missense	possibly damaging	0.46
R1765:Smchd1	UTSW	17	71400201	splice site	probably benign
R1766:Smchd1	UTSW	17	71391379	missense	probably damaging	0.99
R1803:Smchd1	UTSW	17	71387006	missense	probably damaging	0.99
R1829:Smchd1	UTSW	17	71370337	missense	probably damaging	1.00
R1850:Smchd1	UTSW	17	71389771	missense	probably damaging	0.99
R1917:Smchd1	UTSW	17	71407237	missense	possibly damaging	0.48
R1918:Smchd1	UTSW	17	71407237	missense	possibly damaging	0.48
R1936:Smchd1	UTSW	17	71463791	missense	probably damaging	1.00
R2024:Smchd1	UTSW	17	71370928	missense	probably benign	0.15
R2147:Smchd1	UTSW	17	71398588	missense	possibly damaging	0.93
R2180:Smchd1	UTSW	17	71463799	missense	probably benign	0.23
R2398:Smchd1	UTSW	17	71360141	missense	probably damaging	1.00
R2398:Smchd1	UTSW	17	71426436	splice site	probably benign
R2935:Smchd1	UTSW	17	71411905	missense	probably damaging	1.00
R3000:Smchd1	UTSW	17	71363038	missense	probably benign	0.00
R3021:Smchd1	UTSW	17	71387098	missense	possibly damaging	0.75
R3808:Smchd1	UTSW	17	71429541	missense	probably damaging	1.00
R4323:Smchd1	UTSW	17	71428275	missense	probably benign	0.00
R4486:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4487:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4488:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4489:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4723:Smchd1	UTSW	17	71436747	nonsense	probably null
R4751:Smchd1	UTSW	17	71391468	missense	probably benign	0.01
R4798:Smchd1	UTSW	17	71360053	nonsense	probably null
R4814:Smchd1	UTSW	17	71411768	critical splice donor site	probably null
R4882:Smchd1	UTSW	17	71358239	intron	probably benign
R5088:Smchd1	UTSW	17	71431348	missense	possibly damaging	0.86
R5589:Smchd1	UTSW	17	71440961	missense	probably damaging	1.00
R5618:Smchd1	UTSW	17	71455727	missense	probably damaging	1.00
R5839:Smchd1	UTSW	17	71394862	missense	probably damaging	0.98
R5994:Smchd1	UTSW	17	71365409	missense	possibly damaging	0.89
R6009:Smchd1	UTSW	17	71440956	missense	probably damaging	1.00
R6042:Smchd1	UTSW	17	71377057	nonsense	probably null
R6082:Smchd1	UTSW	17	71349719	missense	probably benign	0.09
R6126:Smchd1	UTSW	17	71370285	missense	probably damaging	1.00
R6294:Smchd1	UTSW	17	71370927	missense	probably benign	0.13
R6788:Smchd1	UTSW	17	71475101	missense	probably benign	0.02
R6853:Smchd1	UTSW	17	71436743	missense	probably damaging	1.00
R6875:Smchd1	UTSW	17	71353506	missense	probably damaging	1.00
R7026:Smchd1	UTSW	17	71349667	missense	probably benign
R7045:Smchd1	UTSW	17	71415044	missense	probably benign	0.22
R7068:Smchd1	UTSW	17	71387092	missense	probably benign	0.00
R7085:Smchd1	UTSW	17	71365219	splice site	probably null
R7089:Smchd1	UTSW	17	71361960	missense	probably benign	0.00
R7145:Smchd1	UTSW	17	71378207	missense	probably benign
R7158:Smchd1	UTSW	17	71400150	missense	probably damaging	0.99
R7180:Smchd1	UTSW	17	71394823	missense	probably damaging	0.99
R7183:Smchd1	UTSW	17	71353516	missense	probably benign	0.00
R7214:Smchd1	UTSW	17	71345364	missense	probably benign	0.15
R7414:Smchd1	UTSW	17	71475079	missense	probably damaging	0.99
R7512:Smchd1	UTSW	17	71381369	missense	possibly damaging	0.51
R7631:Smchd1	UTSW	17	71398689	missense	probably benign	0.10
R7641:Smchd1	UTSW	17	71390479	missense	probably benign	0.00
R7709:Smchd1	UTSW	17	71358198	missense	probably damaging	1.00
R7768:Smchd1	UTSW	17	71411911	missense	probably damaging	1.00
R7789:Smchd1	UTSW	17	71475301	start gained	probably benign
R7898:Smchd1	UTSW	17	71377818	splice site	probably null
R7965:Smchd1	UTSW	17	71455626	missense	possibly damaging	0.65
R8177:Smchd1	UTSW	17	71390453	missense	probably benign	0.28
R8359:Smchd1	UTSW	17	71431243	missense	probably damaging	0.99
R8370:Smchd1	UTSW	17	71394913	missense	probably benign	0.22
R8426:Smchd1	UTSW	17	71448603	missense	probably damaging	1.00
R8443:Smchd1	UTSW	17	71407249	missense	probably benign	0.18
R8948:Smchd1	UTSW	17	71436772	missense	probably damaging	1.00
R8954:Smchd1	UTSW	17	71448757	missense	probably damaging	1.00
R9041:Smchd1	UTSW	17	71394715	critical splice donor site	probably null
R9054:Smchd1	UTSW	17	71363022	nonsense	probably null
R9141:Smchd1	UTSW	17	71365130	missense	probably benign	0.00
R9169:Smchd1	UTSW	17	71415664	missense	probably damaging	1.00
R9231:Smchd1	UTSW	17	71365089	missense	probably benign	0.05
R9368:Smchd1	UTSW	17	71387076	missense	probably damaging	1.00
R9374:Smchd1	UTSW	17	71411848	missense	possibly damaging	0.61
R9416:Smchd1	UTSW	17	71394796	missense	probably benign	0.27
R9426:Smchd1	UTSW	17	71365130	missense	probably benign	0.00
R9491:Smchd1	UTSW	17	71360025	critical splice donor site	probably null
R9511:Smchd1	UTSW	17	71443904	missense	possibly damaging	0.65
R9591:Smchd1	UTSW	17	71394833	missense	probably damaging	1.00
R9593:Smchd1	UTSW	17	71394833	missense	probably damaging	1.00
Z1176:Smchd1	UTSW	17	71361841	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTCACAATCATTCCTGCTTCACG -3'
(R):5'- AAGAGCTTAGGAAGGCCCTTGCAC -3'

Sequencing Primer
(F):5'- TGATCTGGTAGCACAAATCTCC -3'
(R):5'- CATAAGAAGCCTTTCTGTCTTTGG -3'

Posted On

2014-03-28