Incidental Mutation 'R1473:Smchd1'
ID 165965
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene Name SMC hinge domain containing 1
Synonyms MommeD1, 4931400A14Rik
MMRRC Submission 039526-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.874) question?
Stock # R1473 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 71651484-71782338 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 71668832 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
AlphaFold Q6P5D8
Predicted Effect probably benign
Transcript: ENSMUST00000127430
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191623
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,056,668 (GRCm39) D342G probably damaging Het
Acad8 T C 9: 26,890,337 (GRCm39) T293A probably benign Het
Adamts13 C A 2: 26,871,765 (GRCm39) Y310* probably null Het
Adcy6 T A 15: 98,490,624 (GRCm39) Y1102F probably damaging Het
Ahctf1 G A 1: 179,603,673 (GRCm39) T791M probably benign Het
Ahctf1 A G 1: 179,626,844 (GRCm39) V18A probably damaging Het
Ahcyl T A 16: 45,975,182 (GRCm39) E65V probably damaging Het
Ampd3 T G 7: 110,404,142 (GRCm39) S564R probably damaging Het
Anapc1 A T 2: 128,459,617 (GRCm39) I1814K possibly damaging Het
Arl4c A T 1: 88,629,331 (GRCm39) L19Q probably damaging Het
Atp6v0e2 T C 6: 48,516,198 (GRCm39) Y49H probably damaging Het
Ccdc121rt3 T C 5: 112,502,415 (GRCm39) T430A probably benign Het
Ccdc24 G T 4: 117,727,101 (GRCm39) probably benign Het
Ceacam23 A G 7: 17,639,016 (GRCm39) noncoding transcript Het
Clcn6 A C 4: 148,108,613 (GRCm39) F139V possibly damaging Het
Col2a1 A G 15: 97,880,789 (GRCm39) probably benign Het
Crip2 T A 12: 113,107,120 (GRCm39) C29S probably damaging Het
Cyp2a4 A C 7: 26,014,188 (GRCm39) N455T probably benign Het
Dhcr7 T C 7: 143,400,805 (GRCm39) Y323H probably damaging Het
Dhcr7 A G 7: 143,395,105 (GRCm39) D113G probably damaging Het
Dnah7a A C 1: 53,535,173 (GRCm39) S2696A probably benign Het
Dnajc12 A G 10: 63,233,023 (GRCm39) T55A probably benign Het
Drosha G A 15: 12,912,606 (GRCm39) E1075K probably benign Het
Duox2 A G 2: 122,117,602 (GRCm39) S911P possibly damaging Het
Ephb2 G A 4: 136,421,369 (GRCm39) A327V possibly damaging Het
Espl1 C T 15: 102,228,878 (GRCm39) T1711I possibly damaging Het
Fmnl2 A G 2: 52,748,219 (GRCm39) K22R possibly damaging Het
Fzd6 T C 15: 38,894,358 (GRCm39) F175L probably damaging Het
Gm6526 A G 14: 43,986,303 (GRCm39) I76M probably damaging Het
Gm9881 A T 16: 90,967,623 (GRCm39) F34I unknown Het
Gm9892 T C 8: 52,649,649 (GRCm39) D148G possibly damaging Het
Grb10 C T 11: 11,884,249 (GRCm39) V486I probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
H2bc18 G T 3: 96,177,388 (GRCm39) L107F probably damaging Het
Hdac4 T C 1: 91,957,690 (GRCm39) H108R possibly damaging Het
Hmcn1 G A 1: 150,648,303 (GRCm39) T661I probably benign Het
Icam1 T A 9: 20,939,172 (GRCm39) I515N probably damaging Het
Ifi208 A G 1: 173,523,220 (GRCm39) R497G possibly damaging Het
Igsf10 A T 3: 59,226,188 (GRCm39) V2495E probably damaging Het
Iqgap1 T C 7: 80,383,759 (GRCm39) M1102V probably benign Het
Itgb4 A T 11: 115,874,873 (GRCm39) N410I probably benign Het
Jup T C 11: 100,270,427 (GRCm39) H360R possibly damaging Het
Kif20b T A 19: 34,951,896 (GRCm39) S1685T possibly damaging Het
Lins1 T C 7: 66,361,794 (GRCm39) probably null Het
Lrig1 T A 6: 94,584,294 (GRCm39) T917S probably benign Het
Mast2 A G 4: 116,169,152 (GRCm39) S814P probably damaging Het
Mast4 T C 13: 102,909,027 (GRCm39) T483A probably damaging Het
Mcpt1 T C 14: 56,256,990 (GRCm39) M176T probably benign Het
Mettl22 A G 16: 8,291,825 (GRCm39) Q38R probably damaging Het
Mrm2 T C 5: 140,314,443 (GRCm39) T131A probably benign Het
Mtcl2 A T 2: 156,862,368 (GRCm39) Y1520* probably null Het
Nde1 T G 16: 14,003,728 (GRCm39) F71V probably benign Het
Nxn C T 11: 76,154,013 (GRCm39) G274D possibly damaging Het
Or4c123 A T 2: 89,127,250 (GRCm39) Y121* probably null Het
Or5h17 A T 16: 58,820,275 (GRCm39) T76S probably benign Het
Or6k14 G T 1: 173,927,315 (GRCm39) C97F probably damaging Het
Or6p1 T A 1: 174,258,209 (GRCm39) W72R probably damaging Het
Osbp2 T C 11: 3,667,175 (GRCm39) probably null Het
Otud7a C A 7: 63,404,377 (GRCm39) probably benign Het
Phf3 G A 1: 30,845,021 (GRCm39) L1313F probably damaging Het
Pkhd1 A T 1: 20,593,207 (GRCm39) D1635E probably benign Het
Plpp1 A G 13: 112,996,198 (GRCm39) H171R probably damaging Het
Pofut1 A G 2: 153,103,166 (GRCm39) M172V probably damaging Het
Prmt5 A G 14: 54,746,372 (GRCm39) F580L probably damaging Het
Rab11fip3 A T 17: 26,210,296 (GRCm39) L987Q probably damaging Het
Retnlb T A 16: 48,639,028 (GRCm39) C76* probably null Het
Rnf38 T C 4: 44,131,584 (GRCm39) N399S probably benign Het
Sbk1 A G 7: 125,891,424 (GRCm39) E286G possibly damaging Het
Scin T A 12: 40,127,501 (GRCm39) T430S probably benign Het
Sgsm1 T A 5: 113,411,123 (GRCm39) T868S probably benign Het
Sipa1l1 G A 12: 82,387,885 (GRCm39) R37H probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Stk32c C T 7: 138,705,095 (GRCm39) R23Q probably damaging Het
Sult1d1 A G 5: 87,712,598 (GRCm39) M82T probably benign Het
Tat T C 8: 110,723,550 (GRCm39) L346P probably damaging Het
Tenm3 C A 8: 48,763,660 (GRCm39) G789V probably damaging Het
Thsd7a C T 6: 12,338,621 (GRCm39) S1203N probably benign Het
Tmem191 G A 16: 17,095,826 (GRCm39) probably null Het
Tmem268 A G 4: 63,498,575 (GRCm39) T239A probably damaging Het
Tmem82 A C 4: 141,343,589 (GRCm39) L227R possibly damaging Het
Ttn A T 2: 76,557,376 (GRCm39) I29906N probably damaging Het
Txndc15 T C 13: 55,869,387 (GRCm39) probably benign Het
Ubqln4 A G 3: 88,473,152 (GRCm39) I536V probably benign Het
Unc80 C T 1: 66,560,740 (GRCm39) H823Y possibly damaging Het
Vmn2r102 A T 17: 19,914,843 (GRCm39) I803F probably benign Het
Vmn2r6 G T 3: 64,445,579 (GRCm39) Y715* probably null Het
Vmn2r74 A T 7: 85,610,618 (GRCm39) C25S probably damaging Het
Wdr38 A G 2: 38,890,991 (GRCm39) T261A probably benign Het
Zfp653 T C 9: 21,969,516 (GRCm39) E250G possibly damaging Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71,772,668 (GRCm39) splice site probably benign
IGL00529:Smchd1 APN 17 71,701,794 (GRCm39) missense probably benign 0.30
IGL00642:Smchd1 APN 17 71,697,427 (GRCm39) missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71,705,618 (GRCm39) missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71,743,783 (GRCm39) missense probably benign
IGL01432:Smchd1 APN 17 71,738,285 (GRCm39) missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71,696,745 (GRCm39) missense probably benign 0.00
IGL01705:Smchd1 APN 17 71,688,393 (GRCm39) missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71,698,413 (GRCm39) missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71,685,182 (GRCm39) missense probably benign 0.01
IGL01976:Smchd1 APN 17 71,701,720 (GRCm39) nonsense probably null
IGL01995:Smchd1 APN 17 71,751,015 (GRCm39) missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71,738,248 (GRCm39) missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71,665,128 (GRCm39) splice site probably benign
IGL02309:Smchd1 APN 17 71,750,898 (GRCm39) missense probably benign 0.32
IGL02391:Smchd1 APN 17 71,738,254 (GRCm39) missense probably null 1.00
IGL02515:Smchd1 APN 17 71,747,952 (GRCm39) missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71,667,016 (GRCm39) splice site probably benign
IGL03081:Smchd1 APN 17 71,667,186 (GRCm39) missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71,750,886 (GRCm39) missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71,698,425 (GRCm39) missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71,656,695 (GRCm39) missense probably benign 0.01
Dry_tortugas UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R0049:Smchd1 UTSW 17 71,738,231 (GRCm39) missense probably benign 0.01
R0254:Smchd1 UTSW 17 71,718,886 (GRCm39) missense probably benign 0.00
R0391:Smchd1 UTSW 17 71,710,149 (GRCm39) missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71,701,897 (GRCm39) missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71,694,083 (GRCm39) missense probably benign
R0520:Smchd1 UTSW 17 71,736,538 (GRCm39) missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71,686,569 (GRCm39) missense probably benign 0.39
R1120:Smchd1 UTSW 17 71,665,141 (GRCm39) nonsense probably null
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1484:Smchd1 UTSW 17 71,685,252 (GRCm39) missense probably benign 0.31
R1501:Smchd1 UTSW 17 71,672,089 (GRCm39) missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71,755,828 (GRCm39) missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71,707,196 (GRCm39) splice site probably benign
R1766:Smchd1 UTSW 17 71,698,374 (GRCm39) missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71,694,001 (GRCm39) missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71,677,332 (GRCm39) missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71,696,766 (GRCm39) missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71,770,786 (GRCm39) missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71,677,923 (GRCm39) missense probably benign 0.15
R2147:Smchd1 UTSW 17 71,705,583 (GRCm39) missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71,770,794 (GRCm39) missense probably benign 0.23
R2398:Smchd1 UTSW 17 71,733,431 (GRCm39) splice site probably benign
R2398:Smchd1 UTSW 17 71,667,136 (GRCm39) missense probably damaging 1.00
R2935:Smchd1 UTSW 17 71,718,900 (GRCm39) missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71,670,033 (GRCm39) missense probably benign 0.00
R3021:Smchd1 UTSW 17 71,694,093 (GRCm39) missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71,736,536 (GRCm39) missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71,735,270 (GRCm39) missense probably benign 0.00
R4486:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4487:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4488:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4489:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4723:Smchd1 UTSW 17 71,743,742 (GRCm39) nonsense probably null
R4751:Smchd1 UTSW 17 71,698,463 (GRCm39) missense probably benign 0.01
R4798:Smchd1 UTSW 17 71,667,048 (GRCm39) nonsense probably null
R4814:Smchd1 UTSW 17 71,718,763 (GRCm39) critical splice donor site probably null
R4882:Smchd1 UTSW 17 71,665,234 (GRCm39) intron probably benign
R5088:Smchd1 UTSW 17 71,738,343 (GRCm39) missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71,747,956 (GRCm39) missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71,762,722 (GRCm39) missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71,701,857 (GRCm39) missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71,672,404 (GRCm39) missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71,684,052 (GRCm39) nonsense probably null
R6082:Smchd1 UTSW 17 71,656,714 (GRCm39) missense probably benign 0.09
R6126:Smchd1 UTSW 17 71,677,280 (GRCm39) missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71,677,922 (GRCm39) missense probably benign 0.13
R6788:Smchd1 UTSW 17 71,782,096 (GRCm39) missense probably benign 0.02
R6853:Smchd1 UTSW 17 71,743,738 (GRCm39) missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71,660,501 (GRCm39) missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71,656,662 (GRCm39) missense probably benign
R7045:Smchd1 UTSW 17 71,722,039 (GRCm39) missense probably benign 0.22
R7068:Smchd1 UTSW 17 71,694,087 (GRCm39) missense probably benign 0.00
R7085:Smchd1 UTSW 17 71,672,214 (GRCm39) splice site probably null
R7089:Smchd1 UTSW 17 71,668,955 (GRCm39) missense probably benign 0.00
R7145:Smchd1 UTSW 17 71,685,202 (GRCm39) missense probably benign
R7158:Smchd1 UTSW 17 71,707,145 (GRCm39) missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71,701,818 (GRCm39) missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71,660,511 (GRCm39) missense probably benign 0.00
R7214:Smchd1 UTSW 17 71,652,359 (GRCm39) missense probably benign 0.15
R7414:Smchd1 UTSW 17 71,782,074 (GRCm39) missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71,688,364 (GRCm39) missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71,705,684 (GRCm39) missense probably benign 0.10
R7641:Smchd1 UTSW 17 71,697,474 (GRCm39) missense probably benign 0.00
R7709:Smchd1 UTSW 17 71,665,193 (GRCm39) missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71,718,906 (GRCm39) missense probably damaging 1.00
R7789:Smchd1 UTSW 17 71,782,296 (GRCm39) start gained probably benign
R7898:Smchd1 UTSW 17 71,684,813 (GRCm39) splice site probably null
R7965:Smchd1 UTSW 17 71,762,621 (GRCm39) missense possibly damaging 0.65
R8177:Smchd1 UTSW 17 71,697,448 (GRCm39) missense probably benign 0.28
R8359:Smchd1 UTSW 17 71,738,238 (GRCm39) missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71,701,908 (GRCm39) missense probably benign 0.22
R8426:Smchd1 UTSW 17 71,755,598 (GRCm39) missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71,714,244 (GRCm39) missense probably benign 0.18
R8948:Smchd1 UTSW 17 71,743,767 (GRCm39) missense probably damaging 1.00
R8954:Smchd1 UTSW 17 71,755,752 (GRCm39) missense probably damaging 1.00
R9041:Smchd1 UTSW 17 71,701,710 (GRCm39) critical splice donor site probably null
R9054:Smchd1 UTSW 17 71,670,017 (GRCm39) nonsense probably null
R9141:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9169:Smchd1 UTSW 17 71,722,659 (GRCm39) missense probably damaging 1.00
R9231:Smchd1 UTSW 17 71,672,084 (GRCm39) missense probably benign 0.05
R9368:Smchd1 UTSW 17 71,694,071 (GRCm39) missense probably damaging 1.00
R9374:Smchd1 UTSW 17 71,718,843 (GRCm39) missense possibly damaging 0.61
R9416:Smchd1 UTSW 17 71,701,791 (GRCm39) missense probably benign 0.27
R9426:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9491:Smchd1 UTSW 17 71,667,020 (GRCm39) critical splice donor site probably null
R9511:Smchd1 UTSW 17 71,750,899 (GRCm39) missense possibly damaging 0.65
R9591:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
R9593:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71,668,836 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCACAATCATTCCTGCTTCACG -3'
(R):5'- AAGAGCTTAGGAAGGCCCTTGCAC -3'

Sequencing Primer
(F):5'- TGATCTGGTAGCACAAATCTCC -3'
(R):5'- CATAAGAAGCCTTTCTGTCTTTGG -3'
Posted On 2014-03-28