Incidental Mutation 'R1392:Csf1'
ID165970
Institutional Source Beutler Lab
Gene Symbol Csf1
Ensembl Gene ENSMUSG00000014599
Gene Namecolony stimulating factor 1 (macrophage)
Synonymscolony-stimulating factor-1, CSF-1, Csfm, M-CSF
MMRRC Submission 039454-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R1392 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107741048-107760469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107756630 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 74 (V74A)
Ref Sequence ENSEMBL: ENSMUSP00000115480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014743] [ENSMUST00000118593] [ENSMUST00000120243] [ENSMUST00000153114]
Predicted Effect probably benign
Transcript: ENSMUST00000014743
AA Change: V50A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000014743
Gene: ENSMUSG00000014599
AA Change: V50A

DomainStartEndE-ValueType
Pfam:CSF-1 1 254 6.8e-91 PFAM
Pfam:CSF-1 272 552 1.1e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118593
AA Change: V50A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113136
Gene: ENSMUSG00000014599
AA Change: V50A

DomainStartEndE-ValueType
Pfam:CSF-1 1 257 9.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120243
AA Change: V50A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113617
Gene: ENSMUSG00000014599
AA Change: V50A

DomainStartEndE-ValueType
Pfam:CSF-1 1 254 6.8e-91 PFAM
Pfam:CSF-1 272 552 1.1e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153114
AA Change: V74A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000115480
Gene: ENSMUSG00000014599
AA Change: V74A

DomainStartEndE-ValueType
Pfam:CSF-1 26 182 1.1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155557
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.6%
  • 10x: 94.0%
  • 20x: 82.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of macrophages. The active form of the protein is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. The encoded protein may be involved in development of the placenta. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit lack of incisors, a broad domed skull, short thick limb bones with reduced marrow cavities, impaired hearing and vision, and reduced fertility in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Hnrnpm A T 17: 33,658,415 S325T possibly damaging Het
Hunk T C 16: 90,472,464 S299P probably damaging Het
Kcnk4 C T 19: 6,927,663 V207I possibly damaging Het
Mettl7b T C 10: 128,960,698 T81A possibly damaging Het
Myo15 A G 11: 60,477,974 H520R possibly damaging Het
Olfr310 A T 7: 86,268,855 F311L probably benign Het
Olfr351 A T 2: 36,860,175 Y58N probably damaging Het
Phc2 A G 4: 128,745,087 H607R possibly damaging Het
Rsad2 A G 12: 26,445,440 V352A probably benign Het
Rtn4rl2 A G 2: 84,880,512 L136P probably damaging Het
Spef2 C T 15: 9,647,263 V993I probably benign Het
Tiam2 A G 17: 3,414,197 H67R possibly damaging Het
Tmcc1 G C 6: 116,022,110 R323G possibly damaging Het
Tmem246 A G 4: 49,586,919 L83P probably damaging Het
Vmn2r65 A T 7: 84,947,416 S144T probably benign Het
Vmn2r77 A G 7: 86,801,622 T239A probably benign Het
Other mutations in Csf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Csf1 APN 3 107756727 missense probably benign 0.00
IGL00907:Csf1 APN 3 107750346 missense probably damaging 1.00
IGL01644:Csf1 APN 3 107753842 missense possibly damaging 0.84
R0022:Csf1 UTSW 3 107753862 missense probably damaging 0.99
R0025:Csf1 UTSW 3 107748644 missense probably benign
R0025:Csf1 UTSW 3 107748644 missense probably benign
R0350:Csf1 UTSW 3 107748606 missense probably benign 0.01
R1392:Csf1 UTSW 3 107756630 missense probably benign 0.03
R1531:Csf1 UTSW 3 107748338 missense possibly damaging 0.72
R1897:Csf1 UTSW 3 107748279 missense probably damaging 1.00
R4373:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4375:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4376:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4377:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4469:Csf1 UTSW 3 107750681 critical splice donor site probably null
R4474:Csf1 UTSW 3 107753856 missense probably damaging 0.98
R4604:Csf1 UTSW 3 107756962 splice site probably null
R4634:Csf1 UTSW 3 107749167 missense probably damaging 0.96
R5086:Csf1 UTSW 3 107748710 missense possibly damaging 0.72
R5156:Csf1 UTSW 3 107748936 missense probably benign 0.01
R5425:Csf1 UTSW 3 107748896 missense possibly damaging 0.96
R6120:Csf1 UTSW 3 107753854 missense probably damaging 0.96
R6268:Csf1 UTSW 3 107747157 missense possibly damaging 0.86
R6269:Csf1 UTSW 3 107749001 missense probably benign 0.04
R6273:Csf1 UTSW 3 107749163 missense probably damaging 1.00
R6298:Csf1 UTSW 3 107748359 missense possibly damaging 0.96
R7196:Csf1 UTSW 3 107753898 missense possibly damaging 0.91
R7375:Csf1 UTSW 3 107748179 missense possibly damaging 0.96
R7437:Csf1 UTSW 3 107750756 missense probably benign 0.00
R7464:Csf1 UTSW 3 107748875 missense probably benign 0.03
R7780:Csf1 UTSW 3 107750393 missense probably damaging 0.96
R7808:Csf1 UTSW 3 107760045 missense possibly damaging 0.70
R8153:Csf1 UTSW 3 107748704 missense probably damaging 0.98
Z1177:Csf1 UTSW 3 107749080 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CCATAGTGGACATTCCTGGACAACC -3'
(R):5'- GTGGTGCCCTGGCTGATAAGAATC -3'

Sequencing Primer
(F):5'- TAGTCACTACAGGTGACCCAG -3'
(R):5'- tgccctggcTGATAAGAATCTAATG -3'
Posted On2014-03-28