Incidental Mutation 'R1392:Rsad2'
ID165980
Institutional Source Beutler Lab
Gene Symbol Rsad2
Ensembl Gene ENSMUSG00000020641
Gene Nameradical S-adenosyl methionine domain containing 2
Synonymsviperin, cig5, Vig1, 2510004L01Rik
MMRRC Submission 039454-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1392 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location26442746-26456452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26445440 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 352 (V352A)
Ref Sequence ENSEMBL: ENSMUSP00000020970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020970] [ENSMUST00000137792]
Predicted Effect probably benign
Transcript: ENSMUST00000020970
AA Change: V352A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000020970
Gene: ENSMUSG00000020641
AA Change: V352A

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Elp3 74 282 8.55e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137792
SMART Domains Protein: ENSMUSP00000121791
Gene: ENSMUSG00000020641

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Fer4_12 69 174 1.3e-10 PFAM
Pfam:Fer4_14 78 172 7.7e-11 PFAM
Pfam:Radical_SAM 78 178 9.5e-12 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.6%
  • 10x: 94.0%
  • 20x: 82.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit impaired T-helper 2 differentitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Csf1 A G 3: 107,756,630 V74A probably benign Het
Hnrnpm A T 17: 33,658,415 S325T possibly damaging Het
Hunk T C 16: 90,472,464 S299P probably damaging Het
Kcnk4 C T 19: 6,927,663 V207I possibly damaging Het
Mettl7b T C 10: 128,960,698 T81A possibly damaging Het
Myo15 A G 11: 60,477,974 H520R possibly damaging Het
Olfr310 A T 7: 86,268,855 F311L probably benign Het
Olfr351 A T 2: 36,860,175 Y58N probably damaging Het
Phc2 A G 4: 128,745,087 H607R possibly damaging Het
Rtn4rl2 A G 2: 84,880,512 L136P probably damaging Het
Spef2 C T 15: 9,647,263 V993I probably benign Het
Tiam2 A G 17: 3,414,197 H67R possibly damaging Het
Tmcc1 G C 6: 116,022,110 R323G possibly damaging Het
Tmem246 A G 4: 49,586,919 L83P probably damaging Het
Vmn2r65 A T 7: 84,947,416 S144T probably benign Het
Vmn2r77 A G 7: 86,801,622 T239A probably benign Het
Other mutations in Rsad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Rsad2 APN 12 26448667 missense probably benign 0.01
IGL02237:Rsad2 APN 12 26456187 missense probably damaging 1.00
R0077:Rsad2 UTSW 12 26456377 missense probably damaging 0.96
R0472:Rsad2 UTSW 12 26454168 missense possibly damaging 0.87
R1368:Rsad2 UTSW 12 26447148 splice site probably null
R1392:Rsad2 UTSW 12 26445440 missense probably benign 0.00
R1393:Rsad2 UTSW 12 26456377 missense probably damaging 0.96
R1860:Rsad2 UTSW 12 26450617 missense probably damaging 1.00
R2286:Rsad2 UTSW 12 26450676 missense probably benign 0.20
R3430:Rsad2 UTSW 12 26456419 start codon destroyed probably null 0.98
R5304:Rsad2 UTSW 12 26450682 missense probably damaging 1.00
R6000:Rsad2 UTSW 12 26447151 critical splice donor site probably null
R6052:Rsad2 UTSW 12 26450578 missense probably benign 0.02
R6084:Rsad2 UTSW 12 26454123 missense probably damaging 1.00
R6193:Rsad2 UTSW 12 26456187 missense probably damaging 1.00
R7019:Rsad2 UTSW 12 26456419 start codon destroyed possibly damaging 0.89
R7158:Rsad2 UTSW 12 26450780 splice site probably null
R7229:Rsad2 UTSW 12 26454123 missense probably damaging 1.00
R8330:Rsad2 UTSW 12 26456406 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGGACCTTGCTCCTCTGAGAAC -3'
(R):5'- ACCATGCTTGGGATGTCGGAAATAC -3'

Sequencing Primer
(F):5'- GAGAACCGAACTCTCTCCTGTG -3'
(R):5'- GGATACCCTCCATTGAGTTTTACAG -3'
Posted On2014-03-28