Incidental Mutation 'R1466:Kif1a'
ID 165990
Institutional Source Beutler Lab
Gene Symbol Kif1a
Ensembl Gene ENSMUSG00000014602
Gene Name kinesin family member 1A
Synonyms N-3 kinesin, C630002N23Rik, Kns1, LOC381283, ATSV
Accession Numbers
Essential gene? Probably essential (E-score: 0.846) question?
Stock # R1466 (G1)
Quality Score 195
Status Not validated
Chromosome 1
Chromosomal Location 92943186-93029673 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92982651 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 718 (W718R)
Ref Sequence ENSEMBL: ENSMUSP00000140163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000190723]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000086819
AA Change: W718R

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: W718R

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 411 429 N/A INTRINSIC
FHA 524 581 1.39e-8 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 6.4e-13 PFAM
Pfam:DUF3694 1157 1305 1.8e-47 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112958
AA Change: W709R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: W709R

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 851 3.9e-15 PFAM
Pfam:DUF3694 1148 1304 5e-40 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171556
AA Change: W709R

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: W709R

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 2.7e-13 PFAM
Pfam:DUF3694 1148 1296 8.4e-48 PFAM
low complexity region 1411 1435 N/A INTRINSIC
low complexity region 1532 1540 N/A INTRINSIC
PH 1575 1674 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171796
AA Change: W709R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: W709R

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 6.4e-13 PFAM
Pfam:DUF3694 1148 1304 1.8e-46 PFAM
low complexity region 1419 1443 N/A INTRINSIC
low complexity region 1540 1548 N/A INTRINSIC
PH 1583 1682 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188493
Predicted Effect possibly damaging
Transcript: ENSMUST00000190723
AA Change: W718R

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: W718R

DomainStartEndE-ValueType
KISc 3 362 5.2e-180 SMART
low complexity region 411 429 N/A INTRINSIC
coiled coil region 438 471 N/A INTRINSIC
FHA 524 581 6.9e-11 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 4e-10 PFAM
low complexity region 885 900 N/A INTRINSIC
coiled coil region 901 929 N/A INTRINSIC
internal_repeat_1 938 957 5.9e-5 PROSPERO
Pfam:DUF3694 1250 1398 1.1e-44 PFAM
low complexity region 1513 1537 N/A INTRINSIC
low complexity region 1634 1642 N/A INTRINSIC
PH 1677 1776 6.9e-16 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
Adamts12 T C 15: 11,311,445 (GRCm39) F1234S probably benign Het
Ahnak A G 19: 8,993,239 (GRCm39) D4841G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arhgef17 G T 7: 100,578,866 (GRCm39) P694Q possibly damaging Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Aspg A G 12: 112,088,286 (GRCm39) N385D probably benign Het
Atxn3 G A 12: 101,892,758 (GRCm39) R319C possibly damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
C1s1 C T 6: 124,508,090 (GRCm39) C633Y probably damaging Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Cbl A T 9: 44,065,541 (GRCm39) V706E probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cfhr1 C T 1: 139,485,312 (GRCm39) E45K probably benign Het
Chd7 G A 4: 8,840,561 (GRCm39) probably null Het
Chek1 G T 9: 36,637,153 (GRCm39) A2E probably damaging Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Crb2 T C 2: 37,673,400 (GRCm39) Y99H probably damaging Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Cym G A 3: 107,120,774 (GRCm39) T277I probably damaging Het
Cyp2d11 C T 15: 82,275,936 (GRCm39) C215Y probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dnah10 T A 5: 124,840,160 (GRCm39) Y1265N probably benign Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Efhb A G 17: 53,744,206 (GRCm39) F462L probably damaging Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Fat3 A C 9: 16,286,778 (GRCm39) V915G probably damaging Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Galnt4 A G 10: 98,944,571 (GRCm39) R99G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Gm10110 A T 14: 90,135,511 (GRCm39) noncoding transcript Het
Gm4884 A G 7: 40,692,552 (GRCm39) K174E probably damaging Het
Grip2 A T 6: 91,765,424 (GRCm39) D19E probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T A 8: 111,259,585 (GRCm39) V2519E possibly damaging Het
Ints11 G A 4: 155,972,567 (GRCm39) probably null Het
Kif1b A T 4: 149,307,709 (GRCm39) Y839N probably damaging Het
Kif20b T A 19: 34,927,999 (GRCm39) V1047D probably benign Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Klra10 T A 6: 130,256,278 (GRCm39) R125S probably damaging Het
Klra10 T C 6: 130,256,394 (GRCm39) N87D probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Map4k2 G T 19: 6,391,947 (GRCm39) W87L probably damaging Het
Mccc1 A G 3: 36,028,435 (GRCm39) V457A probably benign Het
Mdn1 T A 4: 32,730,788 (GRCm39) S2886T probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrpl24 T A 3: 87,829,235 (GRCm39) Y21* probably null Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Mtcl1 T A 17: 66,687,430 (GRCm39) D492V probably damaging Het
Muc2 A G 7: 141,302,711 (GRCm39) Y457C probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Myg1 T A 15: 102,245,825 (GRCm39) L275Q probably damaging Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or12d13 A T 17: 37,647,847 (GRCm39) L92H probably benign Het
Or13a18 A G 7: 140,190,882 (GRCm39) I268V probably benign Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pcdh10 T G 3: 45,334,409 (GRCm39) L241R probably damaging Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Ppef1 C A X: 159,408,670 (GRCm39) probably null Het
Prkaa1 C A 15: 5,208,279 (GRCm39) P507T probably benign Het
Ptch1 A G 13: 63,672,783 (GRCm39) Y804H probably benign Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rfx5 T A 3: 94,863,614 (GRCm39) Y88N probably damaging Het
Rnase2b A T 14: 51,400,296 (GRCm39) K126* probably null Het
Rpl3l A G 17: 24,949,845 (GRCm39) I15V probably benign Het
Saal1 G T 7: 46,351,969 (GRCm39) probably null Het
Sbpl A C 17: 24,172,228 (GRCm39) D230E unknown Het
Scn10a T C 9: 119,495,556 (GRCm39) Y322C probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc25a36 A G 9: 96,962,408 (GRCm39) F194L probably damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Slc7a11 G T 3: 50,335,522 (GRCm39) probably null Het
Slco4c1 A T 1: 96,768,897 (GRCm39) S322T probably damaging Het
Smarcc2 A T 10: 128,310,114 (GRCm39) T376S probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Syp A T X: 7,514,944 (GRCm39) probably benign Het
Tas1r2 A G 4: 139,396,722 (GRCm39) D687G probably damaging Het
Tekt4 A T 17: 25,691,048 (GRCm39) Q118L probably benign Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tph2 T C 10: 114,915,600 (GRCm39) N480S probably benign Het
Tsc2 A T 17: 24,827,947 (GRCm39) M839K probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Uaca C T 9: 60,761,603 (GRCm39) A205V possibly damaging Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Zfp704 G T 3: 9,512,408 (GRCm39) T288N possibly damaging Het
Zfp93 T C 7: 23,975,521 (GRCm39) V502A probably damaging Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Kif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kif1a APN 1 92,982,656 (GRCm39) missense probably damaging 1.00
IGL01574:Kif1a APN 1 93,010,062 (GRCm39) missense probably damaging 1.00
IGL01637:Kif1a APN 1 92,967,575 (GRCm39) missense possibly damaging 0.95
IGL01895:Kif1a APN 1 92,953,455 (GRCm39) missense possibly damaging 0.65
IGL02215:Kif1a APN 1 92,948,271 (GRCm39) missense probably benign 0.05
IGL02571:Kif1a APN 1 92,948,178 (GRCm39) critical splice donor site probably null
IGL02734:Kif1a APN 1 92,990,280 (GRCm39) missense probably damaging 1.00
IGL02752:Kif1a APN 1 92,967,569 (GRCm39) missense possibly damaging 0.92
IGL02990:Kif1a APN 1 92,966,985 (GRCm39) missense probably damaging 1.00
IGL03298:Kif1a APN 1 92,993,903 (GRCm39) missense probably damaging 1.00
IGL03309:Kif1a APN 1 92,986,579 (GRCm39) nonsense probably null
IGL03354:Kif1a APN 1 92,987,957 (GRCm39) missense probably damaging 1.00
asbestos UTSW 1 92,950,227 (GRCm39) missense probably damaging 1.00
chrysolite UTSW 1 93,002,670 (GRCm39) splice site probably benign
osmium UTSW 1 92,986,532 (GRCm39) splice site probably benign
R4538_Kif1a_397 UTSW 1 93,004,769 (GRCm39) missense probably damaging 1.00
1mM(1):Kif1a UTSW 1 93,004,790 (GRCm39) missense probably benign 0.00
IGL03046:Kif1a UTSW 1 93,010,128 (GRCm39) missense probably damaging 1.00
PIT4508001:Kif1a UTSW 1 92,974,451 (GRCm39) missense probably damaging 1.00
R0025:Kif1a UTSW 1 92,970,080 (GRCm39) missense probably damaging 1.00
R0115:Kif1a UTSW 1 92,974,500 (GRCm39) splice site probably benign
R0243:Kif1a UTSW 1 92,969,815 (GRCm39) missense probably damaging 1.00
R0270:Kif1a UTSW 1 92,982,164 (GRCm39) splice site probably benign
R0335:Kif1a UTSW 1 92,980,288 (GRCm39) splice site probably benign
R0380:Kif1a UTSW 1 92,983,753 (GRCm39) critical splice acceptor site probably null
R0472:Kif1a UTSW 1 92,946,719 (GRCm39) missense probably damaging 0.99
R0501:Kif1a UTSW 1 92,983,967 (GRCm39) missense probably damaging 1.00
R0538:Kif1a UTSW 1 92,971,360 (GRCm39) missense probably damaging 0.99
R0628:Kif1a UTSW 1 92,947,605 (GRCm39) missense probably damaging 1.00
R0848:Kif1a UTSW 1 92,947,620 (GRCm39) missense probably damaging 1.00
R1110:Kif1a UTSW 1 92,951,175 (GRCm39) splice site probably benign
R1132:Kif1a UTSW 1 92,983,743 (GRCm39) missense probably damaging 0.99
R1387:Kif1a UTSW 1 92,983,672 (GRCm39) splice site probably benign
R1466:Kif1a UTSW 1 92,982,651 (GRCm39) missense possibly damaging 0.68
R1544:Kif1a UTSW 1 93,002,670 (GRCm39) splice site probably benign
R1569:Kif1a UTSW 1 92,986,532 (GRCm39) splice site probably benign
R1802:Kif1a UTSW 1 92,993,871 (GRCm39) missense probably damaging 1.00
R1917:Kif1a UTSW 1 92,946,753 (GRCm39) missense possibly damaging 0.95
R1919:Kif1a UTSW 1 92,946,753 (GRCm39) missense possibly damaging 0.95
R1999:Kif1a UTSW 1 92,988,517 (GRCm39) missense probably damaging 0.98
R2000:Kif1a UTSW 1 92,982,051 (GRCm39) missense probably damaging 0.99
R2276:Kif1a UTSW 1 92,996,199 (GRCm39) splice site probably benign
R2307:Kif1a UTSW 1 93,006,491 (GRCm39) missense probably damaging 1.00
R2919:Kif1a UTSW 1 92,974,464 (GRCm39) missense probably damaging 1.00
R3440:Kif1a UTSW 1 92,964,575 (GRCm39) missense possibly damaging 0.53
R3441:Kif1a UTSW 1 92,964,575 (GRCm39) missense possibly damaging 0.53
R3618:Kif1a UTSW 1 93,004,765 (GRCm39) missense probably null 1.00
R3957:Kif1a UTSW 1 92,953,416 (GRCm39) missense probably damaging 1.00
R4010:Kif1a UTSW 1 92,950,131 (GRCm39) missense probably benign 0.42
R4013:Kif1a UTSW 1 93,004,014 (GRCm39) missense probably damaging 1.00
R4017:Kif1a UTSW 1 93,004,014 (GRCm39) missense probably damaging 1.00
R4115:Kif1a UTSW 1 92,980,260 (GRCm39) missense probably damaging 1.00
R4386:Kif1a UTSW 1 92,996,272 (GRCm39) missense probably damaging 1.00
R4538:Kif1a UTSW 1 93,004,769 (GRCm39) missense probably damaging 1.00
R4608:Kif1a UTSW 1 92,952,368 (GRCm39) missense possibly damaging 0.81
R4625:Kif1a UTSW 1 92,970,381 (GRCm39) missense probably benign 0.00
R4701:Kif1a UTSW 1 93,006,557 (GRCm39) missense probably damaging 0.99
R4794:Kif1a UTSW 1 92,953,449 (GRCm39) missense probably damaging 1.00
R4830:Kif1a UTSW 1 92,948,931 (GRCm39) splice site probably null
R4903:Kif1a UTSW 1 92,949,456 (GRCm39) missense probably damaging 1.00
R4915:Kif1a UTSW 1 93,002,700 (GRCm39) missense probably benign 0.21
R4918:Kif1a UTSW 1 93,002,700 (GRCm39) missense probably benign 0.21
R4991:Kif1a UTSW 1 93,006,530 (GRCm39) missense probably benign 0.00
R5028:Kif1a UTSW 1 92,982,049 (GRCm39) missense possibly damaging 0.68
R5051:Kif1a UTSW 1 93,003,876 (GRCm39) splice site probably null
R5073:Kif1a UTSW 1 92,950,227 (GRCm39) missense probably damaging 1.00
R5103:Kif1a UTSW 1 92,974,418 (GRCm39) missense probably damaging 1.00
R5314:Kif1a UTSW 1 92,946,220 (GRCm39) missense probably damaging 1.00
R5481:Kif1a UTSW 1 92,987,966 (GRCm39) missense probably benign 0.01
R5510:Kif1a UTSW 1 92,969,414 (GRCm39) missense possibly damaging 0.93
R5610:Kif1a UTSW 1 92,953,450 (GRCm39) missense probably damaging 1.00
R5643:Kif1a UTSW 1 92,983,489 (GRCm39) missense probably damaging 0.98
R5808:Kif1a UTSW 1 92,970,420 (GRCm39) missense probably damaging 0.99
R6027:Kif1a UTSW 1 92,953,365 (GRCm39) missense probably benign 0.33
R6056:Kif1a UTSW 1 92,952,370 (GRCm39) missense probably damaging 1.00
R6077:Kif1a UTSW 1 92,982,618 (GRCm39) missense possibly damaging 0.54
R6120:Kif1a UTSW 1 92,952,296 (GRCm39) splice site probably null
R6126:Kif1a UTSW 1 92,947,621 (GRCm39) missense probably damaging 1.00
R6130:Kif1a UTSW 1 92,964,623 (GRCm39) missense probably damaging 1.00
R6255:Kif1a UTSW 1 92,947,705 (GRCm39) missense probably damaging 1.00
R6301:Kif1a UTSW 1 92,982,663 (GRCm39) nonsense probably null
R6326:Kif1a UTSW 1 93,004,048 (GRCm39) missense probably damaging 1.00
R6594:Kif1a UTSW 1 92,949,035 (GRCm39) missense probably benign 0.00
R6653:Kif1a UTSW 1 93,005,420 (GRCm39) missense probably damaging 1.00
R6791:Kif1a UTSW 1 92,993,859 (GRCm39) missense probably damaging 1.00
R6853:Kif1a UTSW 1 92,967,524 (GRCm39) missense possibly damaging 0.47
R7022:Kif1a UTSW 1 92,993,820 (GRCm39) missense probably benign 0.31
R7059:Kif1a UTSW 1 92,974,551 (GRCm39) intron probably benign
R7103:Kif1a UTSW 1 93,005,507 (GRCm39) missense probably damaging 1.00
R7248:Kif1a UTSW 1 92,969,305 (GRCm39) missense probably benign 0.35
R7259:Kif1a UTSW 1 93,001,532 (GRCm39) nonsense probably null
R7424:Kif1a UTSW 1 92,982,039 (GRCm39) missense possibly damaging 0.89
R7659:Kif1a UTSW 1 92,974,542 (GRCm39) intron probably benign
R7681:Kif1a UTSW 1 92,982,666 (GRCm39) missense probably benign
R7976:Kif1a UTSW 1 92,967,496 (GRCm39) missense probably damaging 1.00
R8056:Kif1a UTSW 1 92,982,423 (GRCm39) intron probably benign
R8420:Kif1a UTSW 1 92,950,141 (GRCm39) missense probably benign
R8994:Kif1a UTSW 1 92,983,457 (GRCm39) missense possibly damaging 0.77
R9016:Kif1a UTSW 1 92,953,395 (GRCm39) missense probably damaging 1.00
R9206:Kif1a UTSW 1 92,979,202 (GRCm39) missense probably damaging 0.99
R9246:Kif1a UTSW 1 93,005,501 (GRCm39) missense probably damaging 0.98
R9252:Kif1a UTSW 1 93,002,776 (GRCm39) missense probably damaging 1.00
R9388:Kif1a UTSW 1 93,000,029 (GRCm39) critical splice donor site probably null
R9413:Kif1a UTSW 1 92,949,019 (GRCm39) missense probably benign 0.00
R9612:Kif1a UTSW 1 92,953,416 (GRCm39) missense probably damaging 1.00
R9621:Kif1a UTSW 1 92,983,445 (GRCm39) missense probably benign
R9625:Kif1a UTSW 1 93,000,766 (GRCm39) missense probably benign 0.42
R9694:Kif1a UTSW 1 92,950,173 (GRCm39) missense probably benign
Z1176:Kif1a UTSW 1 92,950,213 (GRCm39) missense probably damaging 1.00
Z1176:Kif1a UTSW 1 92,949,038 (GRCm39) missense probably damaging 0.97
Z1176:Kif1a UTSW 1 92,983,419 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACCATTCATCCATGCCGTGAAAG -3'
(R):5'- TGGACTGAAAACAGGGCACACTC -3'

Sequencing Primer
(F):5'- ccccccGCTTGTTGACTC -3'
(R):5'- CAGCTAGTCCTGTGGCATC -3'
Posted On 2014-03-28