Incidental Mutation 'R1466:Uhmk1'
ID 165994
Institutional Source Beutler Lab
Gene Symbol Uhmk1
Ensembl Gene ENSMUSG00000026667
Gene Name U2AF homology motif (UHM) kinase 1
Synonyms C820018A03Rik, Kist, OTTMUSG00000021542, KIS
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock # R1466 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 170193420-170215397 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 170208653 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027979] [ENSMUST00000123399] [ENSMUST00000150821]
AlphaFold P97343
Predicted Effect probably null
Transcript: ENSMUST00000027979
SMART Domains Protein: ENSMUSP00000027979
Gene: ENSMUSG00000026667

Pfam:Pkinase_Tyr 23 298 4.1e-22 PFAM
Pfam:Pkinase 23 304 1.3e-40 PFAM
Pfam:Kdo 65 187 2.6e-7 PFAM
RRM 320 402 2.47e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123399
SMART Domains Protein: ENSMUSP00000120787
Gene: ENSMUSG00000026667

Pfam:Pkinase_Tyr 23 299 1.8e-22 PFAM
Pfam:Pkinase 23 304 4.6e-43 PFAM
low complexity region 325 341 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150821
SMART Domains Protein: ENSMUSP00000115622
Gene: ENSMUSG00000026667

Pfam:Pkinase_Tyr 1 210 7e-16 PFAM
Pfam:Pkinase 2 215 1.2e-34 PFAM
RRM 231 313 2.47e-5 SMART
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a serine/threonine protein kinase that promotes cell cycle progression through G1 by phosphorylation of the cyclin-dependent kinase inhibitor 1B (p27Kip1), which causes nuclear export and degradation. The encoded protein is also thought to function in the adult nervous system and the gene has been associated with schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice with disruptions in this gene show accelerated development of neointima after arterial injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
Adamts12 T C 15: 11,311,359 F1234S probably benign Het
Ahnak A G 19: 9,015,875 D4841G probably damaging Het
Akap13 T C 7: 75,729,049 S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arhgef17 G T 7: 100,929,659 P694Q possibly damaging Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
Aspg A G 12: 112,121,852 N385D probably benign Het
Atxn3 G A 12: 101,926,499 R319C possibly damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
C1s1 C T 6: 124,531,131 C633Y probably damaging Het
C8g C T 2: 25,500,216 A6T probably benign Het
Cbl A T 9: 44,154,244 V706E probably benign Het
Cfhr1 C T 1: 139,557,574 E45K probably benign Het
Chd7 G A 4: 8,840,561 probably null Het
Chek1 G T 9: 36,725,857 A2E probably damaging Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Corin C T 5: 72,302,790 probably null Het
Crb2 T C 2: 37,783,388 Y99H probably damaging Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Cym G A 3: 107,213,458 T277I probably damaging Het
Cyp2d11 C T 15: 82,391,735 C215Y probably benign Het
Dido1 G A 2: 180,662,328 P1261L probably damaging Het
Dnah10 T A 5: 124,763,096 Y1265N probably benign Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Efhb A G 17: 53,437,178 F462L probably damaging Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Fat3 A C 9: 16,375,482 V915G probably damaging Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Galnt4 A G 10: 99,108,709 R99G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Glcci1 C T 6: 8,537,964 T6I probably damaging Het
Gm10110 A T 14: 89,898,075 noncoding transcript Het
Gm4884 A G 7: 41,043,128 K174E probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grip2 A T 6: 91,788,443 D19E probably damaging Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T A 8: 110,532,953 V2519E possibly damaging Het
Ints11 G A 4: 155,888,110 probably null Het
Kif1a A G 1: 93,054,929 W718R possibly damaging Het
Kif1b A T 4: 149,223,252 Y839N probably damaging Het
Kif20b T A 19: 34,950,599 V1047D probably benign Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Klra10 T A 6: 130,279,315 R125S probably damaging Het
Klra10 T C 6: 130,279,431 N87D probably damaging Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Map4k2 G T 19: 6,341,917 W87L probably damaging Het
Mccc1 A G 3: 35,974,286 V457A probably benign Het
Mdn1 T A 4: 32,730,788 S2886T probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mrpl24 T A 3: 87,921,928 Y21* probably null Het
Mrps35 C T 6: 147,055,984 T169M probably damaging Het
Mtcl1 T A 17: 66,380,435 D492V probably damaging Het
Muc2 A G 7: 141,748,974 Y457C probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Myg1 T A 15: 102,337,390 L275Q probably damaging Het
Naga T A 15: 82,334,788 M237L probably null Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 F251I probably damaging Het
Olfr103 A T 17: 37,336,956 L92H probably benign Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr46 A G 7: 140,610,969 I268V probably benign Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pcdh10 T G 3: 45,379,974 L241R probably damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Ppef1 C A X: 160,625,674 probably null Het
Prkaa1 C A 15: 5,178,798 P507T probably benign Het
Ptch1 A G 13: 63,524,969 Y804H probably benign Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rfx5 T A 3: 94,956,303 Y88N probably damaging Het
Rnase2b A T 14: 51,162,839 K126* probably null Het
Rpl3l A G 17: 24,730,871 I15V probably benign Het
Saal1 G T 7: 46,702,545 probably null Het
Sbpl A C 17: 23,953,254 D230E unknown Het
Scn10a T C 9: 119,666,490 Y322C probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc25a36 A G 9: 97,080,355 F194L probably damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc7a11 G T 3: 50,381,073 probably null Het
Slco4c1 A T 1: 96,841,172 S322T probably damaging Het
Smarcc2 A T 10: 128,474,245 T376S probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
St3gal3 A C 4: 118,107,662 M1R probably null Het
Syp A T X: 7,648,705 probably benign Het
Tas1r2 A G 4: 139,669,411 D687G probably damaging Het
Tekt4 A T 17: 25,472,074 Q118L probably benign Het
Tph2 T C 10: 115,079,695 N480S probably benign Het
Tsc2 A T 17: 24,608,973 M839K probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Uaca C T 9: 60,854,321 A205V possibly damaging Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Zfp704 G T 3: 9,447,348 T288N possibly damaging Het
Zfp93 T C 7: 24,276,096 V502A probably damaging Het
Zzef1 C T 11: 72,924,679 P2942S probably damaging Het
Other mutations in Uhmk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Uhmk1 APN 1 170207113 critical splice donor site probably null
IGL02451:Uhmk1 APN 1 170212526 missense possibly damaging 0.89
R0452:Uhmk1 UTSW 1 170212402 missense possibly damaging 0.92
R0507:Uhmk1 UTSW 1 170207191 missense probably damaging 1.00
R1466:Uhmk1 UTSW 1 170208653 critical splice donor site probably null
R1584:Uhmk1 UTSW 1 170208653 critical splice donor site probably null
R1676:Uhmk1 UTSW 1 170200012 missense probably damaging 1.00
R1806:Uhmk1 UTSW 1 170211059 missense probably damaging 0.98
R2039:Uhmk1 UTSW 1 170212267 missense probably damaging 1.00
R4567:Uhmk1 UTSW 1 170205117 nonsense probably null
R4658:Uhmk1 UTSW 1 170207205 missense probably damaging 1.00
R4765:Uhmk1 UTSW 1 170199901 missense probably damaging 1.00
R5186:Uhmk1 UTSW 1 170211167 missense probably damaging 1.00
R5686:Uhmk1 UTSW 1 170211218 missense probably damaging 1.00
R6210:Uhmk1 UTSW 1 170212237 missense probably damaging 1.00
R6238:Uhmk1 UTSW 1 170199994 missense probably damaging 0.99
R6253:Uhmk1 UTSW 1 170199880 missense probably damaging 1.00
R6682:Uhmk1 UTSW 1 170212235 critical splice donor site probably null
R7522:Uhmk1 UTSW 1 170215240 start codon destroyed probably benign 0.00
R7582:Uhmk1 UTSW 1 170200001 missense probably damaging 1.00
R7916:Uhmk1 UTSW 1 170205188 missense possibly damaging 0.46
R9097:Uhmk1 UTSW 1 170215310 unclassified probably benign
R9483:Uhmk1 UTSW 1 170207344 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gccttgaactcacagagatcc -3'
Posted On 2014-03-28