Incidental Mutation 'R1466:Sec16a'
ID 165997
Institutional Source Beutler Lab
Gene Symbol Sec16a
Ensembl Gene ENSMUSG00000026924
Gene Name SEC16 homolog A, endoplasmic reticulum export factor
Synonyms C230052J16Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R1466 (G1)
Quality Score 218
Status Not validated
Chromosome 2
Chromosomal Location 26299443-26335228 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26321169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 1308 (Y1308N)
Ref Sequence ENSEMBL: ENSMUSP00000088796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]
AlphaFold E9QAT4
Predicted Effect probably damaging
Transcript: ENSMUST00000091252
AA Change: Y1308N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: Y1308N

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114082
AA Change: Y1308N

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: Y1308N

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153996
SMART Domains Protein: ENSMUSP00000121179
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
low complexity region 154 170 N/A INTRINSIC
low complexity region 205 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156442
SMART Domains Protein: ENSMUSP00000122255
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
Pfam:Sec16 14 114 7.7e-11 PFAM
low complexity region 150 164 N/A INTRINSIC
Pfam:Sec16_C 186 438 1.6e-45 PFAM
low complexity region 659 674 N/A INTRINSIC
low complexity region 715 727 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 777 792 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
Adamts12 T C 15: 11,311,445 (GRCm39) F1234S probably benign Het
Ahnak A G 19: 8,993,239 (GRCm39) D4841G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arhgef17 G T 7: 100,578,866 (GRCm39) P694Q possibly damaging Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Aspg A G 12: 112,088,286 (GRCm39) N385D probably benign Het
Atxn3 G A 12: 101,892,758 (GRCm39) R319C possibly damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
C1s1 C T 6: 124,508,090 (GRCm39) C633Y probably damaging Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Cbl A T 9: 44,065,541 (GRCm39) V706E probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cfhr1 C T 1: 139,485,312 (GRCm39) E45K probably benign Het
Chd7 G A 4: 8,840,561 (GRCm39) probably null Het
Chek1 G T 9: 36,637,153 (GRCm39) A2E probably damaging Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Crb2 T C 2: 37,673,400 (GRCm39) Y99H probably damaging Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Cym G A 3: 107,120,774 (GRCm39) T277I probably damaging Het
Cyp2d11 C T 15: 82,275,936 (GRCm39) C215Y probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dnah10 T A 5: 124,840,160 (GRCm39) Y1265N probably benign Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Efhb A G 17: 53,744,206 (GRCm39) F462L probably damaging Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Fat3 A C 9: 16,286,778 (GRCm39) V915G probably damaging Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Galnt4 A G 10: 98,944,571 (GRCm39) R99G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Gm10110 A T 14: 90,135,511 (GRCm39) noncoding transcript Het
Gm4884 A G 7: 40,692,552 (GRCm39) K174E probably damaging Het
Grip2 A T 6: 91,765,424 (GRCm39) D19E probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T A 8: 111,259,585 (GRCm39) V2519E possibly damaging Het
Ints11 G A 4: 155,972,567 (GRCm39) probably null Het
Kif1a A G 1: 92,982,651 (GRCm39) W718R possibly damaging Het
Kif1b A T 4: 149,307,709 (GRCm39) Y839N probably damaging Het
Kif20b T A 19: 34,927,999 (GRCm39) V1047D probably benign Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Klra10 T A 6: 130,256,278 (GRCm39) R125S probably damaging Het
Klra10 T C 6: 130,256,394 (GRCm39) N87D probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Map4k2 G T 19: 6,391,947 (GRCm39) W87L probably damaging Het
Mccc1 A G 3: 36,028,435 (GRCm39) V457A probably benign Het
Mdn1 T A 4: 32,730,788 (GRCm39) S2886T probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrpl24 T A 3: 87,829,235 (GRCm39) Y21* probably null Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Mtcl1 T A 17: 66,687,430 (GRCm39) D492V probably damaging Het
Muc2 A G 7: 141,302,711 (GRCm39) Y457C probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Myg1 T A 15: 102,245,825 (GRCm39) L275Q probably damaging Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or12d13 A T 17: 37,647,847 (GRCm39) L92H probably benign Het
Or13a18 A G 7: 140,190,882 (GRCm39) I268V probably benign Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pcdh10 T G 3: 45,334,409 (GRCm39) L241R probably damaging Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Ppef1 C A X: 159,408,670 (GRCm39) probably null Het
Prkaa1 C A 15: 5,208,279 (GRCm39) P507T probably benign Het
Ptch1 A G 13: 63,672,783 (GRCm39) Y804H probably benign Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rfx5 T A 3: 94,863,614 (GRCm39) Y88N probably damaging Het
Rnase2b A T 14: 51,400,296 (GRCm39) K126* probably null Het
Rpl3l A G 17: 24,949,845 (GRCm39) I15V probably benign Het
Saal1 G T 7: 46,351,969 (GRCm39) probably null Het
Sbpl A C 17: 24,172,228 (GRCm39) D230E unknown Het
Scn10a T C 9: 119,495,556 (GRCm39) Y322C probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc25a36 A G 9: 96,962,408 (GRCm39) F194L probably damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Slc7a11 G T 3: 50,335,522 (GRCm39) probably null Het
Slco4c1 A T 1: 96,768,897 (GRCm39) S322T probably damaging Het
Smarcc2 A T 10: 128,310,114 (GRCm39) T376S probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Syp A T X: 7,514,944 (GRCm39) probably benign Het
Tas1r2 A G 4: 139,396,722 (GRCm39) D687G probably damaging Het
Tekt4 A T 17: 25,691,048 (GRCm39) Q118L probably benign Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tph2 T C 10: 114,915,600 (GRCm39) N480S probably benign Het
Tsc2 A T 17: 24,827,947 (GRCm39) M839K probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Uaca C T 9: 60,761,603 (GRCm39) A205V possibly damaging Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Zfp704 G T 3: 9,512,408 (GRCm39) T288N possibly damaging Het
Zfp93 T C 7: 23,975,521 (GRCm39) V502A probably damaging Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Sec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sec16a APN 2 26,329,499 (GRCm39) missense probably benign 0.15
IGL00435:Sec16a APN 2 26,320,113 (GRCm39) missense probably benign 0.00
IGL00469:Sec16a APN 2 26,318,312 (GRCm39) missense probably damaging 1.00
IGL01622:Sec16a APN 2 26,328,915 (GRCm39) missense probably benign 0.00
IGL01623:Sec16a APN 2 26,328,915 (GRCm39) missense probably benign 0.00
IGL02158:Sec16a APN 2 26,306,644 (GRCm39) critical splice donor site probably null
IGL02188:Sec16a APN 2 26,326,020 (GRCm39) missense probably damaging 1.00
IGL02445:Sec16a APN 2 26,312,052 (GRCm39) missense probably benign
IGL02568:Sec16a APN 2 26,326,054 (GRCm39) missense probably damaging 1.00
IGL02710:Sec16a APN 2 26,320,142 (GRCm39) missense possibly damaging 0.75
IGL02735:Sec16a APN 2 26,318,149 (GRCm39) splice site probably benign
IGL02964:Sec16a APN 2 26,309,735 (GRCm39) missense probably benign 0.00
IGL03027:Sec16a APN 2 26,313,601 (GRCm39) missense probably benign 0.13
IGL03073:Sec16a APN 2 26,329,195 (GRCm39) missense probably benign 0.02
IGL03297:Sec16a APN 2 26,329,202 (GRCm39) missense probably benign 0.05
IGL03339:Sec16a APN 2 26,325,945 (GRCm39) missense probably benign
H8562:Sec16a UTSW 2 26,331,517 (GRCm39) missense probably benign
IGL03050:Sec16a UTSW 2 26,305,759 (GRCm39) missense probably damaging 1.00
PIT4486001:Sec16a UTSW 2 26,315,785 (GRCm39) missense
R0039:Sec16a UTSW 2 26,313,926 (GRCm39) missense probably benign 0.03
R0095:Sec16a UTSW 2 26,315,772 (GRCm39) splice site probably null
R0095:Sec16a UTSW 2 26,315,772 (GRCm39) splice site probably null
R0189:Sec16a UTSW 2 26,314,426 (GRCm39) splice site probably null
R0255:Sec16a UTSW 2 26,321,198 (GRCm39) missense probably damaging 0.97
R0278:Sec16a UTSW 2 26,318,328 (GRCm39) missense probably damaging 1.00
R0739:Sec16a UTSW 2 26,331,063 (GRCm39) missense possibly damaging 0.94
R0743:Sec16a UTSW 2 26,309,734 (GRCm39) missense possibly damaging 0.67
R1446:Sec16a UTSW 2 26,313,579 (GRCm39) missense probably benign 0.00
R1466:Sec16a UTSW 2 26,321,169 (GRCm39) missense probably damaging 0.98
R1501:Sec16a UTSW 2 26,330,057 (GRCm39) missense probably benign 0.16
R1524:Sec16a UTSW 2 26,318,394 (GRCm39) missense probably damaging 1.00
R1584:Sec16a UTSW 2 26,321,169 (GRCm39) missense probably damaging 0.98
R1649:Sec16a UTSW 2 26,315,536 (GRCm39) missense probably damaging 1.00
R1744:Sec16a UTSW 2 26,329,198 (GRCm39) missense probably damaging 1.00
R1959:Sec16a UTSW 2 26,320,144 (GRCm39) missense probably benign 0.00
R1973:Sec16a UTSW 2 26,316,501 (GRCm39) missense probably damaging 1.00
R2005:Sec16a UTSW 2 26,329,092 (GRCm39) missense probably benign 0.27
R2073:Sec16a UTSW 2 26,330,251 (GRCm39) missense probably damaging 1.00
R2074:Sec16a UTSW 2 26,330,251 (GRCm39) missense probably damaging 1.00
R2075:Sec16a UTSW 2 26,330,251 (GRCm39) missense probably damaging 1.00
R2151:Sec16a UTSW 2 26,303,757 (GRCm39) intron probably benign
R2472:Sec16a UTSW 2 26,329,948 (GRCm39) missense probably damaging 1.00
R2512:Sec16a UTSW 2 26,329,037 (GRCm39) missense probably benign 0.00
R2520:Sec16a UTSW 2 26,331,368 (GRCm39) nonsense probably null
R2571:Sec16a UTSW 2 26,329,343 (GRCm39) missense probably benign 0.08
R3105:Sec16a UTSW 2 26,328,433 (GRCm39) missense probably benign 0.14
R3508:Sec16a UTSW 2 26,315,862 (GRCm39) missense probably damaging 1.00
R3809:Sec16a UTSW 2 26,331,825 (GRCm39) missense possibly damaging 0.71
R3912:Sec16a UTSW 2 26,304,399 (GRCm39) missense probably damaging 0.97
R4292:Sec16a UTSW 2 26,312,167 (GRCm39) missense probably benign 0.01
R4293:Sec16a UTSW 2 26,312,167 (GRCm39) missense probably benign 0.01
R4294:Sec16a UTSW 2 26,312,167 (GRCm39) missense probably benign 0.01
R4576:Sec16a UTSW 2 26,321,131 (GRCm39) nonsense probably null
R4611:Sec16a UTSW 2 26,331,817 (GRCm39) missense probably benign 0.04
R4627:Sec16a UTSW 2 26,321,080 (GRCm39) splice site probably null
R4627:Sec16a UTSW 2 26,319,405 (GRCm39) missense probably damaging 1.00
R4662:Sec16a UTSW 2 26,320,582 (GRCm39) missense probably damaging 1.00
R4665:Sec16a UTSW 2 26,302,970 (GRCm39) intron probably benign
R4906:Sec16a UTSW 2 26,331,979 (GRCm39) unclassified probably benign
R4967:Sec16a UTSW 2 26,302,883 (GRCm39) missense probably benign 0.00
R4983:Sec16a UTSW 2 26,329,531 (GRCm39) missense probably benign
R5033:Sec16a UTSW 2 26,309,661 (GRCm39) missense probably benign 0.00
R5251:Sec16a UTSW 2 26,329,357 (GRCm39) missense probably benign 0.00
R5391:Sec16a UTSW 2 26,330,044 (GRCm39) missense possibly damaging 0.82
R5457:Sec16a UTSW 2 26,330,280 (GRCm39) missense probably benign 0.01
R5530:Sec16a UTSW 2 26,329,264 (GRCm39) missense probably benign 0.00
R5645:Sec16a UTSW 2 26,329,907 (GRCm39) missense probably benign 0.01
R5661:Sec16a UTSW 2 26,329,649 (GRCm39) missense probably benign 0.01
R5770:Sec16a UTSW 2 26,304,402 (GRCm39) missense probably damaging 0.99
R5830:Sec16a UTSW 2 26,330,853 (GRCm39) missense probably benign 0.15
R5866:Sec16a UTSW 2 26,309,650 (GRCm39) missense probably benign 0.00
R5875:Sec16a UTSW 2 26,323,379 (GRCm39) missense probably damaging 1.00
R5906:Sec16a UTSW 2 26,328,843 (GRCm39) missense possibly damaging 0.63
R5922:Sec16a UTSW 2 26,305,651 (GRCm39) missense probably benign 0.05
R6076:Sec16a UTSW 2 26,313,954 (GRCm39) missense probably damaging 1.00
R6091:Sec16a UTSW 2 26,316,482 (GRCm39) missense probably damaging 1.00
R6295:Sec16a UTSW 2 26,318,253 (GRCm39) missense probably damaging 1.00
R6302:Sec16a UTSW 2 26,315,817 (GRCm39) missense probably damaging 1.00
R6309:Sec16a UTSW 2 26,328,583 (GRCm39) missense probably benign 0.00
R6459:Sec16a UTSW 2 26,313,512 (GRCm39) missense probably benign 0.04
R6520:Sec16a UTSW 2 26,316,118 (GRCm39) missense probably damaging 1.00
R6631:Sec16a UTSW 2 26,329,969 (GRCm39) missense probably damaging 1.00
R6657:Sec16a UTSW 2 26,315,876 (GRCm39) nonsense probably null
R6750:Sec16a UTSW 2 26,330,030 (GRCm39) missense probably benign 0.00
R6852:Sec16a UTSW 2 26,331,431 (GRCm39) missense probably damaging 0.99
R6860:Sec16a UTSW 2 26,320,124 (GRCm39) missense probably damaging 1.00
R6967:Sec16a UTSW 2 26,320,498 (GRCm39) missense probably damaging 1.00
R6968:Sec16a UTSW 2 26,320,498 (GRCm39) missense probably damaging 1.00
R6970:Sec16a UTSW 2 26,320,498 (GRCm39) missense probably damaging 1.00
R6991:Sec16a UTSW 2 26,320,498 (GRCm39) missense probably damaging 1.00
R6993:Sec16a UTSW 2 26,313,586 (GRCm39) missense probably damaging 0.99
R7009:Sec16a UTSW 2 26,326,014 (GRCm39) nonsense probably null
R7057:Sec16a UTSW 2 26,315,277 (GRCm39) missense probably damaging 1.00
R7186:Sec16a UTSW 2 26,330,715 (GRCm39) nonsense probably null
R7227:Sec16a UTSW 2 26,328,935 (GRCm39) missense probably benign 0.01
R7234:Sec16a UTSW 2 26,329,780 (GRCm39) missense probably damaging 1.00
R7259:Sec16a UTSW 2 26,331,604 (GRCm39) missense probably benign 0.00
R7326:Sec16a UTSW 2 26,329,729 (GRCm39) missense unknown
R7371:Sec16a UTSW 2 26,331,734 (GRCm39) missense probably benign
R7388:Sec16a UTSW 2 26,318,376 (GRCm39) missense
R7414:Sec16a UTSW 2 26,313,643 (GRCm39) missense
R7417:Sec16a UTSW 2 26,311,409 (GRCm39) missense
R7501:Sec16a UTSW 2 26,331,863 (GRCm39) missense probably damaging 1.00
R7558:Sec16a UTSW 2 26,329,746 (GRCm39) missense
R7696:Sec16a UTSW 2 26,305,645 (GRCm39) critical splice donor site probably null
R7981:Sec16a UTSW 2 26,311,384 (GRCm39) critical splice donor site probably null
R8117:Sec16a UTSW 2 26,331,441 (GRCm39) missense probably benign 0.00
R8131:Sec16a UTSW 2 26,300,958 (GRCm39) missense
R8163:Sec16a UTSW 2 26,306,433 (GRCm39) missense
R8825:Sec16a UTSW 2 26,313,586 (GRCm39) missense
R8855:Sec16a UTSW 2 26,329,852 (GRCm39) missense probably benign 0.16
R9165:Sec16a UTSW 2 26,313,645 (GRCm39) missense
R9216:Sec16a UTSW 2 26,304,401 (GRCm39) missense
R9283:Sec16a UTSW 2 26,313,904 (GRCm39) missense
R9506:Sec16a UTSW 2 26,319,384 (GRCm39) critical splice donor site probably null
R9581:Sec16a UTSW 2 26,328,647 (GRCm39) missense
R9772:Sec16a UTSW 2 26,329,417 (GRCm39) missense possibly damaging 0.87
X0011:Sec16a UTSW 2 26,305,655 (GRCm39) missense probably damaging 1.00
X0034:Sec16a UTSW 2 26,306,709 (GRCm39) missense probably benign 0.07
X0062:Sec16a UTSW 2 26,306,709 (GRCm39) missense probably benign 0.07
Z1088:Sec16a UTSW 2 26,329,105 (GRCm39) missense probably damaging 0.99
Z1176:Sec16a UTSW 2 26,328,760 (GRCm39) missense
Z1177:Sec16a UTSW 2 26,329,333 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCAGTGCTTCCTCTTTCAAACAC -3'
(R):5'- AGGCTGGGGCTATAACTGTAGCATC -3'

Sequencing Primer
(F):5'- CTTTCAAACACTAGATCACTTCTCAG -3'
(R):5'- TACTTGCATTGGGAGACCAGC -3'
Posted On 2014-03-28