Incidental Mutation 'R1466:Orc4'
ID 166002
Institutional Source Beutler Lab
Gene Symbol Orc4
Ensembl Gene ENSMUSG00000026761
Gene Name origin recognition complex, subunit 4
Synonyms Orc4, Orc4l, Orc4P, mMmORC4
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R1466 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 48792836-48840289 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 48799506 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 324 (C324S)
Ref Sequence ENSEMBL: ENSMUSP00000028098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028098]
AlphaFold O88708
Predicted Effect possibly damaging
Transcript: ENSMUST00000028098
AA Change: C324S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028098
Gene: ENSMUSG00000026761
AA Change: C324S

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Pfam:ORC4_C 225 413 1.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156956
Meta Mutation Damage Score 0.2780 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. This gene encodes a subunit of the ORC complex. Several alternatively spliced transcript variants, some of which encode the same protein, have been reported for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
Adamts12 T C 15: 11,311,445 (GRCm39) F1234S probably benign Het
Ahnak A G 19: 8,993,239 (GRCm39) D4841G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arhgef17 G T 7: 100,578,866 (GRCm39) P694Q possibly damaging Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Aspg A G 12: 112,088,286 (GRCm39) N385D probably benign Het
Atxn3 G A 12: 101,892,758 (GRCm39) R319C possibly damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
C1s1 C T 6: 124,508,090 (GRCm39) C633Y probably damaging Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Cbl A T 9: 44,065,541 (GRCm39) V706E probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cfhr1 C T 1: 139,485,312 (GRCm39) E45K probably benign Het
Chd7 G A 4: 8,840,561 (GRCm39) probably null Het
Chek1 G T 9: 36,637,153 (GRCm39) A2E probably damaging Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Crb2 T C 2: 37,673,400 (GRCm39) Y99H probably damaging Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Cym G A 3: 107,120,774 (GRCm39) T277I probably damaging Het
Cyp2d11 C T 15: 82,275,936 (GRCm39) C215Y probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dnah10 T A 5: 124,840,160 (GRCm39) Y1265N probably benign Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Efhb A G 17: 53,744,206 (GRCm39) F462L probably damaging Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Fat3 A C 9: 16,286,778 (GRCm39) V915G probably damaging Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Galnt4 A G 10: 98,944,571 (GRCm39) R99G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Gm10110 A T 14: 90,135,511 (GRCm39) noncoding transcript Het
Gm4884 A G 7: 40,692,552 (GRCm39) K174E probably damaging Het
Grip2 A T 6: 91,765,424 (GRCm39) D19E probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T A 8: 111,259,585 (GRCm39) V2519E possibly damaging Het
Ints11 G A 4: 155,972,567 (GRCm39) probably null Het
Kif1a A G 1: 92,982,651 (GRCm39) W718R possibly damaging Het
Kif1b A T 4: 149,307,709 (GRCm39) Y839N probably damaging Het
Kif20b T A 19: 34,927,999 (GRCm39) V1047D probably benign Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Klra10 T A 6: 130,256,278 (GRCm39) R125S probably damaging Het
Klra10 T C 6: 130,256,394 (GRCm39) N87D probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Map4k2 G T 19: 6,391,947 (GRCm39) W87L probably damaging Het
Mccc1 A G 3: 36,028,435 (GRCm39) V457A probably benign Het
Mdn1 T A 4: 32,730,788 (GRCm39) S2886T probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrpl24 T A 3: 87,829,235 (GRCm39) Y21* probably null Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Mtcl1 T A 17: 66,687,430 (GRCm39) D492V probably damaging Het
Muc2 A G 7: 141,302,711 (GRCm39) Y457C probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Myg1 T A 15: 102,245,825 (GRCm39) L275Q probably damaging Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or12d13 A T 17: 37,647,847 (GRCm39) L92H probably benign Het
Or13a18 A G 7: 140,190,882 (GRCm39) I268V probably benign Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Pcdh10 T G 3: 45,334,409 (GRCm39) L241R probably damaging Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Ppef1 C A X: 159,408,670 (GRCm39) probably null Het
Prkaa1 C A 15: 5,208,279 (GRCm39) P507T probably benign Het
Ptch1 A G 13: 63,672,783 (GRCm39) Y804H probably benign Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rfx5 T A 3: 94,863,614 (GRCm39) Y88N probably damaging Het
Rnase2b A T 14: 51,400,296 (GRCm39) K126* probably null Het
Rpl3l A G 17: 24,949,845 (GRCm39) I15V probably benign Het
Saal1 G T 7: 46,351,969 (GRCm39) probably null Het
Sbpl A C 17: 24,172,228 (GRCm39) D230E unknown Het
Scn10a T C 9: 119,495,556 (GRCm39) Y322C probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc25a36 A G 9: 96,962,408 (GRCm39) F194L probably damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Slc7a11 G T 3: 50,335,522 (GRCm39) probably null Het
Slco4c1 A T 1: 96,768,897 (GRCm39) S322T probably damaging Het
Smarcc2 A T 10: 128,310,114 (GRCm39) T376S probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Syp A T X: 7,514,944 (GRCm39) probably benign Het
Tas1r2 A G 4: 139,396,722 (GRCm39) D687G probably damaging Het
Tekt4 A T 17: 25,691,048 (GRCm39) Q118L probably benign Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tph2 T C 10: 114,915,600 (GRCm39) N480S probably benign Het
Tsc2 A T 17: 24,827,947 (GRCm39) M839K probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Uaca C T 9: 60,761,603 (GRCm39) A205V possibly damaging Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Zfp704 G T 3: 9,512,408 (GRCm39) T288N possibly damaging Het
Zfp93 T C 7: 23,975,521 (GRCm39) V502A probably damaging Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Orc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Orc4 APN 2 48,800,281 (GRCm39) missense probably benign
IGL01523:Orc4 APN 2 48,807,236 (GRCm39) missense probably benign 0.00
IGL02546:Orc4 APN 2 48,807,296 (GRCm39) missense probably null 0.02
IGL02592:Orc4 APN 2 48,823,090 (GRCm39) critical splice donor site probably null
R0277:Orc4 UTSW 2 48,827,479 (GRCm39) missense possibly damaging 0.78
R0323:Orc4 UTSW 2 48,827,479 (GRCm39) missense possibly damaging 0.78
R0554:Orc4 UTSW 2 48,795,433 (GRCm39) missense probably benign 0.01
R0573:Orc4 UTSW 2 48,807,285 (GRCm39) missense probably benign 0.05
R0788:Orc4 UTSW 2 48,827,479 (GRCm39) missense possibly damaging 0.78
R0893:Orc4 UTSW 2 48,822,622 (GRCm39) unclassified probably benign
R1112:Orc4 UTSW 2 48,823,584 (GRCm39) missense probably damaging 0.97
R1466:Orc4 UTSW 2 48,799,506 (GRCm39) missense possibly damaging 0.91
R1584:Orc4 UTSW 2 48,799,506 (GRCm39) missense possibly damaging 0.91
R1868:Orc4 UTSW 2 48,800,305 (GRCm39) missense probably benign 0.07
R2342:Orc4 UTSW 2 48,817,152 (GRCm39) missense probably damaging 0.99
R2370:Orc4 UTSW 2 48,823,111 (GRCm39) missense probably benign 0.01
R3085:Orc4 UTSW 2 48,827,501 (GRCm39) missense probably benign 0.01
R3086:Orc4 UTSW 2 48,827,501 (GRCm39) missense probably benign 0.01
R3122:Orc4 UTSW 2 48,827,501 (GRCm39) missense probably benign 0.01
R3404:Orc4 UTSW 2 48,827,501 (GRCm39) missense probably benign 0.01
R3551:Orc4 UTSW 2 48,827,501 (GRCm39) missense probably benign 0.01
R4199:Orc4 UTSW 2 48,827,501 (GRCm39) missense probably benign 0.01
R4515:Orc4 UTSW 2 48,827,501 (GRCm39) missense probably benign 0.01
R4518:Orc4 UTSW 2 48,827,501 (GRCm39) missense probably benign 0.01
R4519:Orc4 UTSW 2 48,827,501 (GRCm39) missense probably benign 0.01
R4521:Orc4 UTSW 2 48,827,501 (GRCm39) missense probably benign 0.01
R4523:Orc4 UTSW 2 48,827,501 (GRCm39) missense probably benign 0.01
R4529:Orc4 UTSW 2 48,827,501 (GRCm39) missense probably benign 0.01
R4532:Orc4 UTSW 2 48,827,501 (GRCm39) missense probably benign 0.01
R4533:Orc4 UTSW 2 48,827,501 (GRCm39) missense probably benign 0.01
R4652:Orc4 UTSW 2 48,826,762 (GRCm39) unclassified probably benign
R4845:Orc4 UTSW 2 48,799,478 (GRCm39) missense probably benign 0.07
R5893:Orc4 UTSW 2 48,795,559 (GRCm39) nonsense probably null
R6708:Orc4 UTSW 2 48,827,505 (GRCm39) missense probably benign 0.00
R6972:Orc4 UTSW 2 48,817,196 (GRCm39) missense probably benign 0.03
R7572:Orc4 UTSW 2 48,800,248 (GRCm39) missense probably benign 0.01
R7938:Orc4 UTSW 2 48,800,203 (GRCm39) missense possibly damaging 0.79
R9267:Orc4 UTSW 2 48,827,534 (GRCm39) nonsense probably null
R9463:Orc4 UTSW 2 48,826,783 (GRCm39) critical splice donor site probably null
R9472:Orc4 UTSW 2 48,795,563 (GRCm39) missense probably benign 0.03
R9480:Orc4 UTSW 2 48,795,563 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTTGTAACTGCCAACTTGTGGACTG -3'
(R):5'- TGTTGTAGATCATCCCACCCCTAGC -3'

Sequencing Primer
(F):5'- aaaaaaaaaaatCGCTGGATCTGATG -3'
(R):5'- AGTCTAACAAGTTAAATGACTCGTG -3'
Posted On 2014-03-28