Mutagenetix > Incidental Mutation

Incidental Mutation 'R1466:Chd7'

166023

Institutional Source

Beutler Lab

Gene Symbol

Chd7

Ensembl Gene

ENSMUSG00000041235

Gene Name

chromodomain helicase DNA binding protein 7

Synonyms

A730019I05Rik, Cycn, Cyn, Dz, Edy, Flo, GENA 47, Gena 52, GENA 60, Lda, Mt, Obt, Todo, WBE1, Whi

Accession Numbers

Genbank: NM_001081417; MGI: 2444748

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R1466 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8690406-8867659 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 8840561 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000059079 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000051558] [ENSMUST00000170391]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000039267

SMART Domains

Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
low complexity region	585	595	N/A	INTRINSIC
low complexity region	632	696	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
low complexity region	735	748	N/A	INTRINSIC
low complexity region	759	768	N/A	INTRINSIC
CHROMO	789	854	2.54e-9	SMART
CHROMO	870	927	2.94e-5	SMART
low complexity region	928	939	N/A	INTRINSIC
DEXDc	954	1155	9.64e-38	SMART
HELICc	1310	1394	1.67e-23	SMART
Blast:DEXDc	1608	1653	8e-16	BLAST
low complexity region	1728	1739	N/A	INTRINSIC
internal_repeat_2	1774	1825	1.31e-5	PROSPERO
low complexity region	1831	1846	N/A	INTRINSIC
low complexity region	1898	1906	N/A	INTRINSIC
low complexity region	1929	1947	N/A	INTRINSIC
SANT	1952	2011	9.31e-1	SMART
internal_repeat_2	2079	2126	1.31e-5	PROSPERO
low complexity region	2173	2195	N/A	INTRINSIC
low complexity region	2218	2244	N/A	INTRINSIC
low complexity region	2387	2407	N/A	INTRINSIC
low complexity region	2437	2452	N/A	INTRINSIC
BRK	2553	2602	6.57e-23	SMART
BRK	2631	2675	3.77e-23	SMART
low complexity region	2715	2725	N/A	INTRINSIC
low complexity region	2746	2758	N/A	INTRINSIC
low complexity region	2769	2778	N/A	INTRINSIC
low complexity region	2785	2796	N/A	INTRINSIC
low complexity region	2810	2821	N/A	INTRINSIC
low complexity region	2897	2916	N/A	INTRINSIC
low complexity region	2967	2980	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000039267

SMART Domains

Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
low complexity region	585	595	N/A	INTRINSIC
low complexity region	632	696	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
low complexity region	735	748	N/A	INTRINSIC
low complexity region	759	768	N/A	INTRINSIC
CHROMO	789	854	2.54e-9	SMART
CHROMO	870	927	2.94e-5	SMART
low complexity region	928	939	N/A	INTRINSIC
DEXDc	954	1155	9.64e-38	SMART
HELICc	1310	1394	1.67e-23	SMART
Blast:DEXDc	1608	1653	8e-16	BLAST
low complexity region	1728	1739	N/A	INTRINSIC
internal_repeat_2	1774	1825	1.31e-5	PROSPERO
low complexity region	1831	1846	N/A	INTRINSIC
low complexity region	1898	1906	N/A	INTRINSIC
low complexity region	1929	1947	N/A	INTRINSIC
SANT	1952	2011	9.31e-1	SMART
internal_repeat_2	2079	2126	1.31e-5	PROSPERO
low complexity region	2173	2195	N/A	INTRINSIC
low complexity region	2218	2244	N/A	INTRINSIC
low complexity region	2387	2407	N/A	INTRINSIC
low complexity region	2437	2452	N/A	INTRINSIC
BRK	2553	2602	6.57e-23	SMART
BRK	2631	2675	3.77e-23	SMART
low complexity region	2715	2725	N/A	INTRINSIC
low complexity region	2746	2758	N/A	INTRINSIC
low complexity region	2769	2778	N/A	INTRINSIC
low complexity region	2785	2796	N/A	INTRINSIC
low complexity region	2810	2821	N/A	INTRINSIC
low complexity region	2897	2916	N/A	INTRINSIC
low complexity region	2967	2980	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000051558

SMART Domains

Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
low complexity region	585	595	N/A	INTRINSIC
low complexity region	632	696	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
low complexity region	735	748	N/A	INTRINSIC
low complexity region	759	768	N/A	INTRINSIC
CHROMO	789	854	2.54e-9	SMART
CHROMO	870	927	2.94e-5	SMART
low complexity region	928	939	N/A	INTRINSIC
DEXDc	954	1155	9.64e-38	SMART
HELICc	1310	1394	1.67e-23	SMART
Blast:DEXDc	1608	1653	8e-16	BLAST
low complexity region	1728	1739	N/A	INTRINSIC
internal_repeat_2	1774	1825	1.31e-5	PROSPERO
low complexity region	1831	1846	N/A	INTRINSIC
low complexity region	1898	1906	N/A	INTRINSIC
low complexity region	1929	1947	N/A	INTRINSIC
SANT	1952	2011	9.31e-1	SMART
internal_repeat_2	2079	2126	1.31e-5	PROSPERO
low complexity region	2173	2195	N/A	INTRINSIC
low complexity region	2218	2244	N/A	INTRINSIC
low complexity region	2387	2407	N/A	INTRINSIC
low complexity region	2437	2452	N/A	INTRINSIC
BRK	2553	2602	6.57e-23	SMART
BRK	2631	2675	3.77e-23	SMART
low complexity region	2715	2725	N/A	INTRINSIC
low complexity region	2746	2758	N/A	INTRINSIC
low complexity region	2769	2778	N/A	INTRINSIC
low complexity region	2785	2796	N/A	INTRINSIC
low complexity region	2810	2821	N/A	INTRINSIC
low complexity region	2897	2916	N/A	INTRINSIC
low complexity region	2967	2980	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000051558

SMART Domains

Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
low complexity region	585	595	N/A	INTRINSIC
low complexity region	632	696	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
low complexity region	735	748	N/A	INTRINSIC
low complexity region	759	768	N/A	INTRINSIC
CHROMO	789	854	2.54e-9	SMART
CHROMO	870	927	2.94e-5	SMART
low complexity region	928	939	N/A	INTRINSIC
DEXDc	954	1155	9.64e-38	SMART
HELICc	1310	1394	1.67e-23	SMART
Blast:DEXDc	1608	1653	8e-16	BLAST
low complexity region	1728	1739	N/A	INTRINSIC
internal_repeat_2	1774	1825	1.31e-5	PROSPERO
low complexity region	1831	1846	N/A	INTRINSIC
low complexity region	1898	1906	N/A	INTRINSIC
low complexity region	1929	1947	N/A	INTRINSIC
SANT	1952	2011	9.31e-1	SMART
internal_repeat_2	2079	2126	1.31e-5	PROSPERO
low complexity region	2173	2195	N/A	INTRINSIC
low complexity region	2218	2244	N/A	INTRINSIC
low complexity region	2387	2407	N/A	INTRINSIC
low complexity region	2437	2452	N/A	INTRINSIC
BRK	2553	2602	6.57e-23	SMART
BRK	2631	2675	3.77e-23	SMART
low complexity region	2715	2725	N/A	INTRINSIC
low complexity region	2746	2758	N/A	INTRINSIC
low complexity region	2769	2778	N/A	INTRINSIC
low complexity region	2785	2796	N/A	INTRINSIC
low complexity region	2810	2821	N/A	INTRINSIC
low complexity region	2897	2916	N/A	INTRINSIC
low complexity region	2967	2980	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130709

Predicted Effect

probably benign
Transcript: ENSMUST00000170391

SMART Domains

Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
BRK	586	630	3.77e-23	SMART
low complexity region	670	680	N/A	INTRINSIC
low complexity region	701	713	N/A	INTRINSIC
low complexity region	724	733	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	765	776	N/A	INTRINSIC
low complexity region	852	871	N/A	INTRINSIC
low complexity region	922	935	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 97.9%
10x: 90.8%
20x: 71.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]

Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd15	C	T	11: 77,515,410	A71V	probably damaging	Het
Adamts12	T	C	15: 11,311,359	F1234S	probably benign	Het
Ahnak	A	G	19: 9,015,875	D4841G	probably damaging	Het
Akap13	T	C	7: 75,729,049	S2095P	possibly damaging	Het
Ampd2	T	C	3: 108,080,337		probably null	Het
Arhgef17	G	T	7: 100,929,659	P694Q	possibly damaging	Het
Arrdc1	T	C	2: 24,925,795	I398V	probably benign	Het
Ash1l	T	C	3: 89,052,065	Y2250H	probably damaging	Het
Aspg	A	G	12: 112,121,852	N385D	probably benign	Het
Atxn3	G	A	12: 101,926,499	R319C	possibly damaging	Het
BC005561	T	A	5: 104,518,257	I215N	probably damaging	Het
Brca2	G	A	5: 150,552,258	A2478T	probably damaging	Het
C1s1	C	T	6: 124,531,131	C633Y	probably damaging	Het
C8g	C	T	2: 25,500,216	A6T	probably benign	Het
Cbl	A	T	9: 44,154,244	V706E	probably benign	Het
Cfhr1	C	T	1: 139,557,574	E45K	probably benign	Het
Chek1	G	T	9: 36,725,857	A2E	probably damaging	Het
Cntnap1	C	A	11: 101,180,360	F366L	probably damaging	Het
Corin	C	T	5: 72,302,790		probably null	Het
Crb2	T	C	2: 37,783,388	Y99H	probably damaging	Het
Ctdspl2	G	A	2: 122,003,929	R332K	probably benign	Het
Cym	G	A	3: 107,213,458	T277I	probably damaging	Het
Cyp2d11	C	T	15: 82,391,735	C215Y	probably benign	Het
Dido1	G	A	2: 180,662,328	P1261L	probably damaging	Het
Dnah10	T	A	5: 124,763,096	Y1265N	probably benign	Het
Dtx3l	G	A	16: 35,932,728	L503F	probably damaging	Het
Efhb	A	G	17: 53,437,178	F462L	probably damaging	Het
Enpep	T	A	3: 129,319,448	T203S	probably damaging	Het
Fat3	A	C	9: 16,375,482	V915G	probably damaging	Het
Fbln7	A	G	2: 128,877,429	T49A	probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fgf14	T	A	14: 124,676,539	K60M	probably benign	Het
Galnt4	A	G	10: 99,108,709	R99G	probably benign	Het
Gimap4	C	A	6: 48,691,282	Q196K	probably benign	Het
Glcci1	C	T	6: 8,537,964	T6I	probably damaging	Het
Gm10110	A	T	14: 89,898,075		noncoding transcript	Het
Gm4884	A	G	7: 41,043,128	K174E	probably damaging	Het
Gm6583	C	T	5: 112,354,764	G358D	probably benign	Het
Grip2	A	T	6: 91,788,443	D19E	probably damaging	Het
Grk4	T	C	5: 34,694,750	S113P	probably benign	Het
Hectd3	G	A	4: 116,996,566	E220K	probably damaging	Het
Helz2	G	A	2: 181,236,297	P903S	probably damaging	Het
Hydin	T	A	8: 110,532,953	V2519E	possibly damaging	Het
Ints11	G	A	4: 155,888,110		probably null	Het
Kif1a	A	G	1: 93,054,929	W718R	possibly damaging	Het
Kif1b	A	T	4: 149,223,252	Y839N	probably damaging	Het
Kif20b	T	A	19: 34,950,599	V1047D	probably benign	Het
Klhl23	T	C	2: 69,833,888	I527T	probably damaging	Het
Klra10	T	A	6: 130,279,315	R125S	probably damaging	Het
Klra10	T	C	6: 130,279,431	N87D	probably damaging	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lcn4	G	A	2: 26,668,576	P166L	probably damaging	Het
Letmd1	T	A	15: 100,472,542		probably null	Het
Map4k2	G	T	19: 6,341,917	W87L	probably damaging	Het
Mccc1	A	G	3: 35,974,286	V457A	probably benign	Het
Mdn1	T	A	4: 32,730,788	S2886T	probably benign	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Mrpl24	T	A	3: 87,921,928	Y21*	probably null	Het
Mrps35	C	T	6: 147,055,984	T169M	probably damaging	Het
Mtcl1	T	A	17: 66,380,435	D492V	probably damaging	Het
Muc2	A	G	7: 141,748,974	Y457C	probably damaging	Het
Muc4	G	A	16: 32,753,595	G1157D	probably benign	Het
Myg1	T	A	15: 102,337,390	L275Q	probably damaging	Het
Naga	T	A	15: 82,334,788	M237L	probably null	Het
Oc90	T	A	15: 65,897,720	Y96F	probably damaging	Het
Olfr1029	T	A	2: 85,975,995	F251I	probably damaging	Het
Olfr103	A	T	17: 37,336,956	L92H	probably benign	Het
Olfr1253	C	T	2: 89,752,267	C187Y	probably damaging	Het
Olfr46	A	G	7: 140,610,969	I268V	probably benign	Het
Olfr522	A	G	7: 140,162,203	V249A	probably damaging	Het
Orc4	A	T	2: 48,909,494	C324S	possibly damaging	Het
Pcdh10	T	G	3: 45,379,974	L241R	probably damaging	Het
Pdzrn4	T	C	15: 92,770,537	S857P	probably benign	Het
Plec	C	T	15: 76,185,908	E1000K	possibly damaging	Het
Plvap	A	T	8: 71,508,481	V149D	probably benign	Het
Ppef1	C	A	X: 160,625,674		probably null	Het
Prkaa1	C	A	15: 5,178,798	P507T	probably benign	Het
Ptch1	A	G	13: 63,524,969	Y804H	probably benign	Het
R3hdm2	A	G	10: 127,476,690	I434V	probably benign	Het
Rfx5	T	A	3: 94,956,303	Y88N	probably damaging	Het
Rnase2b	A	T	14: 51,162,839	K126*	probably null	Het
Rpl3l	A	G	17: 24,730,871	I15V	probably benign	Het
Saal1	G	T	7: 46,702,545		probably null	Het
Sbpl	A	C	17: 23,953,254	D230E	unknown	Het
Scn10a	T	C	9: 119,666,490	Y322C	probably damaging	Het
Sec16a	A	T	2: 26,431,157	Y1308N	probably damaging	Het
Sis	A	T	3: 72,932,060	D824E	possibly damaging	Het
Slc25a36	A	G	9: 97,080,355	F194L	probably damaging	Het
Slc27a4	T	A	2: 29,811,190	V331E	probably damaging	Het
Slc7a11	G	T	3: 50,381,073		probably null	Het
Slco4c1	A	T	1: 96,841,172	S322T	probably damaging	Het
Smarcc2	A	T	10: 128,474,245	T376S	probably damaging	Het
Srebf1	C	T	11: 60,200,702	R999H	probably benign	Het
St3gal3	A	C	4: 118,107,662	M1R	probably null	Het
Syp	A	T	X: 7,648,705		probably benign	Het
Tas1r2	A	G	4: 139,669,411	D687G	probably damaging	Het
Tekt4	A	T	17: 25,472,074	Q118L	probably benign	Het
Tph2	T	C	10: 115,079,695	N480S	probably benign	Het
Tsc2	A	T	17: 24,608,973	M839K	probably damaging	Het
Ttc22	T	C	4: 106,622,780	F77S	probably damaging	Het
Uaca	C	T	9: 60,854,321	A205V	possibly damaging	Het
Uhmk1	A	T	1: 170,208,653		probably null	Het
Usp17lc	A	G	7: 103,418,941	H481R	possibly damaging	Het
Vwa3a	A	G	7: 120,768,165	Y181C	probably damaging	Het
Wfikkn2	G	A	11: 94,238,895	T140I	probably damaging	Het
Zfp704	G	T	3: 9,447,348	T288N	possibly damaging	Het
Zfp93	T	C	7: 24,276,096	V502A	probably damaging	Het
Zzef1	C	T	11: 72,924,679	P2942S	probably damaging	Het

Other mutations in Chd7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Chd7	APN	4	8859106	missense	probably damaging	1.00
IGL00510:Chd7	APN	4	8801404	missense	probably damaging	1.00
IGL00741:Chd7	APN	4	8839454	missense	probably damaging	1.00
IGL00796:Chd7	APN	4	8847271	missense	possibly damaging	0.95
IGL00907:Chd7	APN	4	8840435	missense	probably damaging	0.98
IGL00930:Chd7	APN	4	8805181	missense	probably damaging	1.00
IGL01542:Chd7	APN	4	8859285	missense	possibly damaging	0.71
IGL01602:Chd7	APN	4	8833834	missense	probably damaging	1.00
IGL01605:Chd7	APN	4	8833834	missense	probably damaging	1.00
IGL01670:Chd7	APN	4	8827033	missense	probably damaging	0.98
IGL02434:Chd7	APN	4	8752145	missense	probably benign	0.00
IGL02531:Chd7	APN	4	8854134	missense	probably damaging	1.00
IGL02626:Chd7	APN	4	8826519	missense	probably damaging	1.00
IGL02961:Chd7	APN	4	8751542	missense	probably damaging	1.00
IGL02972:Chd7	APN	4	8855174	missense	probably benign	0.30
IGL03329:Chd7	APN	4	8841108	missense	probably damaging	1.00
Fili	UTSW	4	8839523	missense	probably damaging	1.00
D4043:Chd7	UTSW	4	8862650	missense	probably damaging	1.00
IGL02991:Chd7	UTSW	4	8828398	missense	possibly damaging	0.91
PIT4466001:Chd7	UTSW	4	8753101	missense	unknown
PIT4472001:Chd7	UTSW	4	8753101	missense	unknown
R0157:Chd7	UTSW	4	8833759	missense	probably damaging	1.00
R0179:Chd7	UTSW	4	8862516	missense	probably benign	0.22
R0240:Chd7	UTSW	4	8852670	unclassified	probably benign
R0388:Chd7	UTSW	4	8854560	missense	probably benign	0.27
R0462:Chd7	UTSW	4	8850821	missense	probably damaging	1.00
R0512:Chd7	UTSW	4	8805139	intron	probably benign
R0657:Chd7	UTSW	4	8753141	missense	probably damaging	1.00
R0799:Chd7	UTSW	4	8801310	intron	probably benign
R0885:Chd7	UTSW	4	8866432	missense	probably damaging	1.00
R1056:Chd7	UTSW	4	8822402	missense	possibly damaging	0.50
R1086:Chd7	UTSW	4	8866458	missense	probably benign	0.04
R1353:Chd7	UTSW	4	8839556	missense	probably damaging	0.99
R1466:Chd7	UTSW	4	8840561	splice site	probably null
R1605:Chd7	UTSW	4	8844675	missense	probably damaging	1.00
R1693:Chd7	UTSW	4	8864307	critical splice donor site	probably null
R1695:Chd7	UTSW	4	8833960	missense	probably damaging	1.00
R1938:Chd7	UTSW	4	8847200	missense	probably damaging	1.00
R1964:Chd7	UTSW	4	8865978	missense	probably damaging	0.96
R2020:Chd7	UTSW	4	8855226	missense	probably benign	0.00
R2134:Chd7	UTSW	4	8753147	missense	probably damaging	0.99
R2171:Chd7	UTSW	4	8752424	missense	probably damaging	1.00
R2271:Chd7	UTSW	4	8785532	missense	probably damaging	1.00
R2300:Chd7	UTSW	4	8855241	missense	probably benign	0.02
R2355:Chd7	UTSW	4	8801350	missense	possibly damaging	0.95
R3153:Chd7	UTSW	4	8855174	missense	probably benign	0.30
R3430:Chd7	UTSW	4	8844517	missense	probably damaging	0.99
R3746:Chd7	UTSW	4	8752537	missense	probably damaging	1.00
R4118:Chd7	UTSW	4	8865831	missense	probably damaging	1.00
R4119:Chd7	UTSW	4	8785658	intron	probably benign
R4332:Chd7	UTSW	4	8854143	missense	probably damaging	1.00
R4402:Chd7	UTSW	4	8866353	missense	possibly damaging	0.61
R4571:Chd7	UTSW	4	8866217	missense	probably benign	0.09
R4722:Chd7	UTSW	4	8822445	missense	probably damaging	1.00
R4821:Chd7	UTSW	4	8844706	missense	probably damaging	1.00
R4894:Chd7	UTSW	4	8838629	missense	probably damaging	0.99
R5205:Chd7	UTSW	4	8752509	missense	possibly damaging	0.60
R5344:Chd7	UTSW	4	8844417	missense	probably damaging	1.00
R5484:Chd7	UTSW	4	8828258	missense	probably damaging	1.00
R5578:Chd7	UTSW	4	8847149	missense	probably benign	0.09
R5583:Chd7	UTSW	4	8752473	missense	probably damaging	1.00
R5888:Chd7	UTSW	4	8866382	missense	probably damaging	0.98
R5905:Chd7	UTSW	4	8840553	missense	possibly damaging	0.91
R6091:Chd7	UTSW	4	8751875	missense	probably damaging	0.99
R6126:Chd7	UTSW	4	8826482	missense	probably damaging	1.00
R6399:Chd7	UTSW	4	8828274	missense	probably damaging	1.00
R6751:Chd7	UTSW	4	8833866	missense	probably damaging	1.00
R6810:Chd7	UTSW	4	8839523	missense	probably damaging	1.00
R6868:Chd7	UTSW	4	8811501	splice site	probably null
R6952:Chd7	UTSW	4	8856797	missense	probably damaging	1.00
R6986:Chd7	UTSW	4	8859285	missense	possibly damaging	0.71
R6990:Chd7	UTSW	4	8844525	missense	probably benign	0.28
R7139:Chd7	UTSW	4	8865865	missense	probably benign	0.00
R7288:Chd7	UTSW	4	8847093	missense	possibly damaging	0.92
R7355:Chd7	UTSW	4	8752196	missense	unknown
R7452:Chd7	UTSW	4	8854731	missense	probably benign	0.03
R7471:Chd7	UTSW	4	8859197	missense	probably damaging	0.96
R7588:Chd7	UTSW	4	8864039	missense	probably damaging	1.00
R7711:Chd7	UTSW	4	8805234	missense	probably benign	0.00
R7744:Chd7	UTSW	4	8862485	splice site	probably null
R7842:Chd7	UTSW	4	8854115	missense	probably benign	0.01
R7883:Chd7	UTSW	4	8826504	missense	probably damaging	1.00
R7934:Chd7	UTSW	4	8854121	missense	probably benign	0.00
R7983:Chd7	UTSW	4	8752628	missense	unknown
R7983:Chd7	UTSW	4	8844609	missense	possibly damaging	0.47
R8022:Chd7	UTSW	4	8751605	missense	unknown
R8161:Chd7	UTSW	4	8855038	missense	probably damaging	1.00
R8274:Chd7	UTSW	4	8839432	missense	probably damaging	1.00
R8278:Chd7	UTSW	4	8862485	splice site	probably null
R8358:Chd7	UTSW	4	8839529	missense	probably damaging	1.00
R8464:Chd7	UTSW	4	8811465	missense	probably benign	0.06
R8483:Chd7	UTSW	4	8822412	missense	possibly damaging	0.65
R8507:Chd7	UTSW	4	8858675	missense	probably damaging	1.00
R8535:Chd7	UTSW	4	8859211	missense	possibly damaging	0.92
R8695:Chd7	UTSW	4	8850812	missense	probably damaging	1.00
R8700:Chd7	UTSW	4	8833892	missense	probably damaging	1.00
R8755:Chd7	UTSW	4	8866069	missense	probably benign	0.31
R8774:Chd7	UTSW	4	8854692	missense	probably damaging	1.00
R8774-TAIL:Chd7	UTSW	4	8854692	missense	probably damaging	1.00
R8796:Chd7	UTSW	4	8838691	missense	probably damaging	1.00
R8992:Chd7	UTSW	4	8839589	missense	probably damaging	1.00
R9018:Chd7	UTSW	4	8847083	missense	possibly damaging	0.88
R9122:Chd7	UTSW	4	8840510	missense	possibly damaging	0.77
R9131:Chd7	UTSW	4	8785642	missense
R9182:Chd7	UTSW	4	8838737	missense	probably damaging	1.00
R9227:Chd7	UTSW	4	8805272	missense	probably benign	0.03
R9254:Chd7	UTSW	4	8752210	missense	unknown
R9379:Chd7	UTSW	4	8752210	missense	unknown
R9388:Chd7	UTSW	4	8865756	missense	possibly damaging	0.89
R9455:Chd7	UTSW	4	8752061	missense	unknown
R9531:Chd7	UTSW	4	8858489	missense
R9577:Chd7	UTSW	4	8752964	missense	unknown
R9634:Chd7	UTSW	4	8832499	missense	probably damaging	1.00
Z1176:Chd7	UTSW	4	8844313	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGCAGAGCAAATCTGTGAAAATCTAC -3'
(R):5'- GAGGTCTTCTATTTCCTTCTTGGACAGC -3'

Sequencing Primer
(F):5'- TCTACAGGCTGATTACAAGGAACTC -3'
(R):5'- aaccaaaaccaaacccaacc -3'

Posted On

2014-03-28