Incidental Mutation 'R1466:Grk4'
ID 166031
Institutional Source Beutler Lab
Gene Symbol Grk4
Ensembl Gene ENSMUSG00000052783
Gene Name G protein-coupled receptor kinase 4
Synonyms Gprk2l, A830025H08Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R1466 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 34817723-34912649 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34852094 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 113 (S113P)
Ref Sequence ENSEMBL: ENSMUSP00000074223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001112] [ENSMUST00000074651]
AlphaFold O70291
Predicted Effect probably benign
Transcript: ENSMUST00000001112
AA Change: S113P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000001112
Gene: ENSMUSG00000052783
AA Change: S113P

RGS 51 171 1.61e-31 SMART
S_TKc 186 448 7.78e-85 SMART
S_TK_X 449 528 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074651
AA Change: S113P

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000074223
Gene: ENSMUSG00000052783
AA Change: S113P

RGS 51 163 1.39e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201216
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating its deactivation. This gene has been linked to both genetic and acquired hypertension. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice heterozygous for a knock-out allele are viable, fertile and overtly normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(2)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
Adamts12 T C 15: 11,311,445 (GRCm39) F1234S probably benign Het
Ahnak A G 19: 8,993,239 (GRCm39) D4841G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arhgef17 G T 7: 100,578,866 (GRCm39) P694Q possibly damaging Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Aspg A G 12: 112,088,286 (GRCm39) N385D probably benign Het
Atxn3 G A 12: 101,892,758 (GRCm39) R319C possibly damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
C1s1 C T 6: 124,508,090 (GRCm39) C633Y probably damaging Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Cbl A T 9: 44,065,541 (GRCm39) V706E probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cfhr1 C T 1: 139,485,312 (GRCm39) E45K probably benign Het
Chd7 G A 4: 8,840,561 (GRCm39) probably null Het
Chek1 G T 9: 36,637,153 (GRCm39) A2E probably damaging Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Crb2 T C 2: 37,673,400 (GRCm39) Y99H probably damaging Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Cym G A 3: 107,120,774 (GRCm39) T277I probably damaging Het
Cyp2d11 C T 15: 82,275,936 (GRCm39) C215Y probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dnah10 T A 5: 124,840,160 (GRCm39) Y1265N probably benign Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Efhb A G 17: 53,744,206 (GRCm39) F462L probably damaging Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Fat3 A C 9: 16,286,778 (GRCm39) V915G probably damaging Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Galnt4 A G 10: 98,944,571 (GRCm39) R99G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Gm10110 A T 14: 90,135,511 (GRCm39) noncoding transcript Het
Gm4884 A G 7: 40,692,552 (GRCm39) K174E probably damaging Het
Grip2 A T 6: 91,765,424 (GRCm39) D19E probably damaging Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T A 8: 111,259,585 (GRCm39) V2519E possibly damaging Het
Ints11 G A 4: 155,972,567 (GRCm39) probably null Het
Kif1a A G 1: 92,982,651 (GRCm39) W718R possibly damaging Het
Kif1b A T 4: 149,307,709 (GRCm39) Y839N probably damaging Het
Kif20b T A 19: 34,927,999 (GRCm39) V1047D probably benign Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Klra10 T A 6: 130,256,278 (GRCm39) R125S probably damaging Het
Klra10 T C 6: 130,256,394 (GRCm39) N87D probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Map4k2 G T 19: 6,391,947 (GRCm39) W87L probably damaging Het
Mccc1 A G 3: 36,028,435 (GRCm39) V457A probably benign Het
Mdn1 T A 4: 32,730,788 (GRCm39) S2886T probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrpl24 T A 3: 87,829,235 (GRCm39) Y21* probably null Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Mtcl1 T A 17: 66,687,430 (GRCm39) D492V probably damaging Het
Muc2 A G 7: 141,302,711 (GRCm39) Y457C probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Myg1 T A 15: 102,245,825 (GRCm39) L275Q probably damaging Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or12d13 A T 17: 37,647,847 (GRCm39) L92H probably benign Het
Or13a18 A G 7: 140,190,882 (GRCm39) I268V probably benign Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pcdh10 T G 3: 45,334,409 (GRCm39) L241R probably damaging Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Ppef1 C A X: 159,408,670 (GRCm39) probably null Het
Prkaa1 C A 15: 5,208,279 (GRCm39) P507T probably benign Het
Ptch1 A G 13: 63,672,783 (GRCm39) Y804H probably benign Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rfx5 T A 3: 94,863,614 (GRCm39) Y88N probably damaging Het
Rnase2b A T 14: 51,400,296 (GRCm39) K126* probably null Het
Rpl3l A G 17: 24,949,845 (GRCm39) I15V probably benign Het
Saal1 G T 7: 46,351,969 (GRCm39) probably null Het
Sbpl A C 17: 24,172,228 (GRCm39) D230E unknown Het
Scn10a T C 9: 119,495,556 (GRCm39) Y322C probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc25a36 A G 9: 96,962,408 (GRCm39) F194L probably damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Slc7a11 G T 3: 50,335,522 (GRCm39) probably null Het
Slco4c1 A T 1: 96,768,897 (GRCm39) S322T probably damaging Het
Smarcc2 A T 10: 128,310,114 (GRCm39) T376S probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Syp A T X: 7,514,944 (GRCm39) probably benign Het
Tas1r2 A G 4: 139,396,722 (GRCm39) D687G probably damaging Het
Tekt4 A T 17: 25,691,048 (GRCm39) Q118L probably benign Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tph2 T C 10: 114,915,600 (GRCm39) N480S probably benign Het
Tsc2 A T 17: 24,827,947 (GRCm39) M839K probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Uaca C T 9: 60,761,603 (GRCm39) A205V possibly damaging Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Zfp704 G T 3: 9,512,408 (GRCm39) T288N possibly damaging Het
Zfp93 T C 7: 23,975,521 (GRCm39) V502A probably damaging Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Grk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Grk4 APN 5 34,873,634 (GRCm39) missense probably damaging 0.99
IGL00574:Grk4 APN 5 34,852,162 (GRCm39) missense probably benign 0.00
IGL02127:Grk4 APN 5 34,867,530 (GRCm39) missense probably benign 0.00
IGL02191:Grk4 APN 5 34,912,533 (GRCm39) missense probably benign 0.27
IGL02227:Grk4 APN 5 34,852,126 (GRCm39) missense probably benign 0.06
IGL03152:Grk4 APN 5 34,902,701 (GRCm39) missense probably damaging 1.00
IGL03214:Grk4 APN 5 34,909,553 (GRCm39) missense probably benign
F5426:Grk4 UTSW 5 34,902,503 (GRCm39) splice site probably benign
R0110:Grk4 UTSW 5 34,873,557 (GRCm39) missense probably damaging 0.97
R0469:Grk4 UTSW 5 34,873,557 (GRCm39) missense probably damaging 0.97
R0671:Grk4 UTSW 5 34,905,611 (GRCm39) missense probably benign 0.04
R1466:Grk4 UTSW 5 34,852,094 (GRCm39) missense probably benign 0.02
R1584:Grk4 UTSW 5 34,852,094 (GRCm39) missense probably benign 0.02
R1605:Grk4 UTSW 5 34,831,901 (GRCm39) missense probably damaging 0.98
R1607:Grk4 UTSW 5 34,888,882 (GRCm39) missense probably benign 0.01
R1903:Grk4 UTSW 5 34,833,531 (GRCm39) splice site probably null
R2352:Grk4 UTSW 5 34,826,520 (GRCm39) missense probably benign 0.04
R4561:Grk4 UTSW 5 34,852,157 (GRCm39) missense probably benign 0.00
R4580:Grk4 UTSW 5 34,818,325 (GRCm39) missense probably damaging 1.00
R4807:Grk4 UTSW 5 34,909,552 (GRCm39) missense probably benign
R5412:Grk4 UTSW 5 34,902,612 (GRCm39) missense probably benign 0.00
R5905:Grk4 UTSW 5 34,869,074 (GRCm39) missense probably damaging 1.00
R6360:Grk4 UTSW 5 34,831,881 (GRCm39) missense probably damaging 1.00
R6604:Grk4 UTSW 5 34,877,208 (GRCm39) missense probably damaging 1.00
R6865:Grk4 UTSW 5 34,888,894 (GRCm39) missense probably damaging 1.00
R7265:Grk4 UTSW 5 34,873,608 (GRCm39) missense probably damaging 0.96
R7394:Grk4 UTSW 5 34,908,962 (GRCm39) missense probably benign
R7718:Grk4 UTSW 5 34,852,160 (GRCm39) missense probably benign
R7821:Grk4 UTSW 5 34,867,553 (GRCm39) missense probably damaging 1.00
R8074:Grk4 UTSW 5 34,833,482 (GRCm39) missense probably benign 0.30
R8218:Grk4 UTSW 5 34,826,540 (GRCm39) missense probably benign 0.01
R8499:Grk4 UTSW 5 34,902,690 (GRCm39) missense possibly damaging 0.90
R9026:Grk4 UTSW 5 34,877,084 (GRCm39) missense probably damaging 1.00
R9068:Grk4 UTSW 5 34,905,653 (GRCm39) missense
X0064:Grk4 UTSW 5 34,877,228 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gcctgcctgttatatcaaacc -3'
Posted On 2014-03-28