Incidental Mutation 'R1466:Dnah10'
ID 166036
Institutional Source Beutler Lab
Gene Symbol Dnah10
Ensembl Gene ENSMUSG00000038011
Gene Name dynein, axonemal, heavy chain 10
Synonyms Dnahc10
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1466 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 124802149-124911372 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124840160 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 1265 (Y1265N)
Ref Sequence ENSEMBL: ENSMUSP00000114593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058440] [ENSMUST00000141137]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000058440
AA Change: Y1322N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011
AA Change: Y1322N

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 305 878 9.1e-154 PFAM
coiled coil region 1191 1218 N/A INTRINSIC
coiled coil region 1337 1360 N/A INTRINSIC
Pfam:DHC_N2 1374 1782 1.7e-142 PFAM
AAA 1946 2082 2.51e-1 SMART
AAA 2225 2373 6.91e-1 SMART
low complexity region 2444 2464 N/A INTRINSIC
AAA 2567 2720 2.29e-2 SMART
Pfam:AAA_8 2886 3153 9.8e-87 PFAM
Pfam:MT 3165 3502 9.1e-53 PFAM
Pfam:AAA_9 3522 3747 2.3e-90 PFAM
Pfam:Dynein_heavy 3884 4588 7.6e-240 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141137
AA Change: Y1265N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011
AA Change: Y1265N

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 304 607 4.3e-57 PFAM
Pfam:DHC_N1 598 823 1.2e-39 PFAM
coiled coil region 1134 1161 N/A INTRINSIC
coiled coil region 1280 1303 N/A INTRINSIC
Pfam:DHC_N2 1315 1727 7.3e-135 PFAM
AAA 1889 2025 4e-3 SMART
AAA 2168 2316 1.1e-2 SMART
low complexity region 2387 2407 N/A INTRINSIC
AAA 2510 2663 3.6e-4 SMART
Pfam:AAA_8 2829 3096 2.5e-83 PFAM
Pfam:MT 3108 3445 1.2e-50 PFAM
Pfam:AAA_9 3461 3691 6.7e-59 PFAM
Pfam:Dynein_heavy 3821 4532 1.9e-231 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
Adamts12 T C 15: 11,311,445 (GRCm39) F1234S probably benign Het
Ahnak A G 19: 8,993,239 (GRCm39) D4841G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arhgef17 G T 7: 100,578,866 (GRCm39) P694Q possibly damaging Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Aspg A G 12: 112,088,286 (GRCm39) N385D probably benign Het
Atxn3 G A 12: 101,892,758 (GRCm39) R319C possibly damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
C1s1 C T 6: 124,508,090 (GRCm39) C633Y probably damaging Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Cbl A T 9: 44,065,541 (GRCm39) V706E probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cfhr1 C T 1: 139,485,312 (GRCm39) E45K probably benign Het
Chd7 G A 4: 8,840,561 (GRCm39) probably null Het
Chek1 G T 9: 36,637,153 (GRCm39) A2E probably damaging Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Crb2 T C 2: 37,673,400 (GRCm39) Y99H probably damaging Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Cym G A 3: 107,120,774 (GRCm39) T277I probably damaging Het
Cyp2d11 C T 15: 82,275,936 (GRCm39) C215Y probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Efhb A G 17: 53,744,206 (GRCm39) F462L probably damaging Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Fat3 A C 9: 16,286,778 (GRCm39) V915G probably damaging Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Galnt4 A G 10: 98,944,571 (GRCm39) R99G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Gm10110 A T 14: 90,135,511 (GRCm39) noncoding transcript Het
Gm4884 A G 7: 40,692,552 (GRCm39) K174E probably damaging Het
Grip2 A T 6: 91,765,424 (GRCm39) D19E probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T A 8: 111,259,585 (GRCm39) V2519E possibly damaging Het
Ints11 G A 4: 155,972,567 (GRCm39) probably null Het
Kif1a A G 1: 92,982,651 (GRCm39) W718R possibly damaging Het
Kif1b A T 4: 149,307,709 (GRCm39) Y839N probably damaging Het
Kif20b T A 19: 34,927,999 (GRCm39) V1047D probably benign Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Klra10 T A 6: 130,256,278 (GRCm39) R125S probably damaging Het
Klra10 T C 6: 130,256,394 (GRCm39) N87D probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Map4k2 G T 19: 6,391,947 (GRCm39) W87L probably damaging Het
Mccc1 A G 3: 36,028,435 (GRCm39) V457A probably benign Het
Mdn1 T A 4: 32,730,788 (GRCm39) S2886T probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrpl24 T A 3: 87,829,235 (GRCm39) Y21* probably null Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Mtcl1 T A 17: 66,687,430 (GRCm39) D492V probably damaging Het
Muc2 A G 7: 141,302,711 (GRCm39) Y457C probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Myg1 T A 15: 102,245,825 (GRCm39) L275Q probably damaging Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or12d13 A T 17: 37,647,847 (GRCm39) L92H probably benign Het
Or13a18 A G 7: 140,190,882 (GRCm39) I268V probably benign Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pcdh10 T G 3: 45,334,409 (GRCm39) L241R probably damaging Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Ppef1 C A X: 159,408,670 (GRCm39) probably null Het
Prkaa1 C A 15: 5,208,279 (GRCm39) P507T probably benign Het
Ptch1 A G 13: 63,672,783 (GRCm39) Y804H probably benign Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rfx5 T A 3: 94,863,614 (GRCm39) Y88N probably damaging Het
Rnase2b A T 14: 51,400,296 (GRCm39) K126* probably null Het
Rpl3l A G 17: 24,949,845 (GRCm39) I15V probably benign Het
Saal1 G T 7: 46,351,969 (GRCm39) probably null Het
Sbpl A C 17: 24,172,228 (GRCm39) D230E unknown Het
Scn10a T C 9: 119,495,556 (GRCm39) Y322C probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc25a36 A G 9: 96,962,408 (GRCm39) F194L probably damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Slc7a11 G T 3: 50,335,522 (GRCm39) probably null Het
Slco4c1 A T 1: 96,768,897 (GRCm39) S322T probably damaging Het
Smarcc2 A T 10: 128,310,114 (GRCm39) T376S probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Syp A T X: 7,514,944 (GRCm39) probably benign Het
Tas1r2 A G 4: 139,396,722 (GRCm39) D687G probably damaging Het
Tekt4 A T 17: 25,691,048 (GRCm39) Q118L probably benign Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tph2 T C 10: 114,915,600 (GRCm39) N480S probably benign Het
Tsc2 A T 17: 24,827,947 (GRCm39) M839K probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Uaca C T 9: 60,761,603 (GRCm39) A205V possibly damaging Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Zfp704 G T 3: 9,512,408 (GRCm39) T288N possibly damaging Het
Zfp93 T C 7: 23,975,521 (GRCm39) V502A probably damaging Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Dnah10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dnah10 APN 5 124,905,667 (GRCm39) missense probably damaging 1.00
IGL00089:Dnah10 APN 5 124,823,680 (GRCm39) missense probably benign 0.01
IGL00471:Dnah10 APN 5 124,871,405 (GRCm39) missense probably damaging 1.00
IGL01336:Dnah10 APN 5 124,852,576 (GRCm39) missense probably damaging 1.00
IGL01339:Dnah10 APN 5 124,854,276 (GRCm39) missense probably damaging 1.00
IGL01372:Dnah10 APN 5 124,856,218 (GRCm39) missense probably damaging 1.00
IGL01572:Dnah10 APN 5 124,861,010 (GRCm39) missense probably damaging 1.00
IGL01634:Dnah10 APN 5 124,898,405 (GRCm39) missense probably damaging 0.98
IGL01649:Dnah10 APN 5 124,809,553 (GRCm39) missense probably damaging 0.97
IGL01676:Dnah10 APN 5 124,880,392 (GRCm39) missense possibly damaging 0.65
IGL01729:Dnah10 APN 5 124,864,529 (GRCm39) missense probably benign 0.10
IGL01757:Dnah10 APN 5 124,845,991 (GRCm39) missense probably benign 0.37
IGL01759:Dnah10 APN 5 124,832,850 (GRCm39) missense probably benign
IGL01767:Dnah10 APN 5 124,820,801 (GRCm39) splice site probably benign
IGL01769:Dnah10 APN 5 124,842,008 (GRCm39) missense possibly damaging 0.63
IGL01805:Dnah10 APN 5 124,860,985 (GRCm39) missense probably damaging 1.00
IGL02090:Dnah10 APN 5 124,866,876 (GRCm39) missense probably damaging 1.00
IGL02162:Dnah10 APN 5 124,881,810 (GRCm39) missense probably damaging 1.00
IGL02312:Dnah10 APN 5 124,896,430 (GRCm39) missense probably damaging 1.00
IGL02347:Dnah10 APN 5 124,910,487 (GRCm39) critical splice acceptor site probably null
IGL02378:Dnah10 APN 5 124,850,131 (GRCm39) missense probably damaging 1.00
IGL02440:Dnah10 APN 5 124,850,883 (GRCm39) missense probably damaging 1.00
IGL02457:Dnah10 APN 5 124,866,860 (GRCm39) missense probably damaging 1.00
IGL02487:Dnah10 APN 5 124,870,916 (GRCm39) missense possibly damaging 0.90
IGL02502:Dnah10 APN 5 124,898,351 (GRCm39) missense probably damaging 1.00
IGL02516:Dnah10 APN 5 124,864,395 (GRCm39) missense probably damaging 1.00
IGL02544:Dnah10 APN 5 124,876,069 (GRCm39) missense probably benign 0.26
IGL02709:Dnah10 APN 5 124,850,809 (GRCm39) nonsense probably null
IGL02740:Dnah10 APN 5 124,903,927 (GRCm39) splice site probably benign
IGL02746:Dnah10 APN 5 124,807,150 (GRCm39) missense possibly damaging 0.55
IGL02803:Dnah10 APN 5 124,875,078 (GRCm39) missense probably damaging 0.99
IGL02900:Dnah10 APN 5 124,878,886 (GRCm39) missense probably damaging 1.00
IGL02957:Dnah10 APN 5 124,840,197 (GRCm39) missense probably benign 0.07
IGL03076:Dnah10 APN 5 124,807,226 (GRCm39) critical splice donor site probably null
IGL03109:Dnah10 APN 5 124,841,950 (GRCm39) missense probably benign 0.10
IGL03181:Dnah10 APN 5 124,825,521 (GRCm39) missense probably damaging 0.99
IGL03185:Dnah10 APN 5 124,894,707 (GRCm39) missense probably damaging 1.00
IGL03199:Dnah10 APN 5 124,894,761 (GRCm39) missense probably benign 0.00
IGL03328:Dnah10 APN 5 124,831,354 (GRCm39) missense probably benign 0.06
frosty UTSW 5 124,905,201 (GRCm39) missense probably damaging 1.00
H8562:Dnah10 UTSW 5 124,906,593 (GRCm39) missense probably damaging 1.00
I2288:Dnah10 UTSW 5 124,807,164 (GRCm39) missense probably benign
P0019:Dnah10 UTSW 5 124,840,130 (GRCm39) missense probably benign
P0037:Dnah10 UTSW 5 124,895,056 (GRCm39) nonsense probably null
PIT4366001:Dnah10 UTSW 5 124,852,588 (GRCm39) missense possibly damaging 0.95
R0004:Dnah10 UTSW 5 124,803,966 (GRCm39) missense probably benign
R0032:Dnah10 UTSW 5 124,877,955 (GRCm39) missense possibly damaging 0.94
R0032:Dnah10 UTSW 5 124,877,955 (GRCm39) missense possibly damaging 0.94
R0050:Dnah10 UTSW 5 124,907,808 (GRCm39) missense probably benign 0.00
R0066:Dnah10 UTSW 5 124,840,140 (GRCm39) missense probably benign 0.01
R0164:Dnah10 UTSW 5 124,860,898 (GRCm39) missense probably damaging 1.00
R0164:Dnah10 UTSW 5 124,860,898 (GRCm39) missense probably damaging 1.00
R0196:Dnah10 UTSW 5 124,911,139 (GRCm39) missense possibly damaging 0.80
R0312:Dnah10 UTSW 5 124,873,433 (GRCm39) splice site probably benign
R0321:Dnah10 UTSW 5 124,900,416 (GRCm39) missense probably benign 0.29
R0410:Dnah10 UTSW 5 124,832,799 (GRCm39) missense probably benign
R0480:Dnah10 UTSW 5 124,885,915 (GRCm39) missense probably damaging 1.00
R0531:Dnah10 UTSW 5 124,889,787 (GRCm39) critical splice donor site probably null
R0533:Dnah10 UTSW 5 124,852,314 (GRCm39) splice site probably null
R0599:Dnah10 UTSW 5 124,878,017 (GRCm39) missense probably damaging 1.00
R0686:Dnah10 UTSW 5 124,824,782 (GRCm39) missense possibly damaging 0.95
R0688:Dnah10 UTSW 5 124,824,782 (GRCm39) missense possibly damaging 0.95
R0780:Dnah10 UTSW 5 124,827,876 (GRCm39) missense possibly damaging 0.87
R0968:Dnah10 UTSW 5 124,906,641 (GRCm39) missense probably damaging 0.99
R0989:Dnah10 UTSW 5 124,875,002 (GRCm39) missense probably benign 0.00
R1203:Dnah10 UTSW 5 124,837,078 (GRCm39) splice site probably null
R1248:Dnah10 UTSW 5 124,832,887 (GRCm39) splice site probably benign
R1366:Dnah10 UTSW 5 124,830,390 (GRCm39) missense probably benign 0.41
R1434:Dnah10 UTSW 5 124,852,050 (GRCm39) missense probably benign 0.03
R1436:Dnah10 UTSW 5 124,839,285 (GRCm39) missense probably benign 0.00
R1438:Dnah10 UTSW 5 124,876,009 (GRCm39) missense probably benign 0.25
R1446:Dnah10 UTSW 5 124,866,860 (GRCm39) missense probably damaging 1.00
R1459:Dnah10 UTSW 5 124,820,750 (GRCm39) missense possibly damaging 0.90
R1466:Dnah10 UTSW 5 124,840,160 (GRCm39) missense probably benign
R1479:Dnah10 UTSW 5 124,854,953 (GRCm39) missense possibly damaging 0.71
R1505:Dnah10 UTSW 5 124,831,303 (GRCm39) missense possibly damaging 0.82
R1519:Dnah10 UTSW 5 124,838,016 (GRCm39) missense probably damaging 0.98
R1565:Dnah10 UTSW 5 124,906,678 (GRCm39) missense probably damaging 1.00
R1668:Dnah10 UTSW 5 124,842,626 (GRCm39) missense probably benign 0.00
R1709:Dnah10 UTSW 5 124,837,155 (GRCm39) missense probably damaging 0.99
R1740:Dnah10 UTSW 5 124,850,254 (GRCm39) splice site probably null
R1828:Dnah10 UTSW 5 124,838,343 (GRCm39) missense probably benign 0.00
R1854:Dnah10 UTSW 5 124,881,753 (GRCm39) missense probably damaging 0.99
R1865:Dnah10 UTSW 5 124,909,590 (GRCm39) splice site probably null
R1893:Dnah10 UTSW 5 124,831,381 (GRCm39) missense probably benign 0.13
R1895:Dnah10 UTSW 5 124,835,494 (GRCm39) missense probably benign 0.00
R1906:Dnah10 UTSW 5 124,878,048 (GRCm39) missense probably damaging 1.00
R1953:Dnah10 UTSW 5 124,859,332 (GRCm39) missense probably benign 0.00
R1965:Dnah10 UTSW 5 124,852,267 (GRCm39) missense probably damaging 1.00
R2002:Dnah10 UTSW 5 124,911,052 (GRCm39) missense probably damaging 1.00
R2006:Dnah10 UTSW 5 124,906,651 (GRCm39) missense possibly damaging 0.58
R2037:Dnah10 UTSW 5 124,823,768 (GRCm39) missense probably benign 0.30
R2046:Dnah10 UTSW 5 124,873,405 (GRCm39) missense probably benign 0.25
R2074:Dnah10 UTSW 5 124,891,738 (GRCm39) missense probably damaging 1.00
R2081:Dnah10 UTSW 5 124,852,045 (GRCm39) missense possibly damaging 0.88
R2257:Dnah10 UTSW 5 124,838,301 (GRCm39) missense probably damaging 1.00
R2272:Dnah10 UTSW 5 124,808,530 (GRCm39) missense probably benign 0.00
R2293:Dnah10 UTSW 5 124,896,285 (GRCm39) missense probably damaging 0.97
R2323:Dnah10 UTSW 5 124,819,064 (GRCm39) missense probably damaging 1.00
R2435:Dnah10 UTSW 5 124,839,929 (GRCm39) critical splice donor site probably null
R2571:Dnah10 UTSW 5 124,852,542 (GRCm39) missense probably damaging 1.00
R2898:Dnah10 UTSW 5 124,894,734 (GRCm39) missense probably damaging 1.00
R2937:Dnah10 UTSW 5 124,896,476 (GRCm39) critical splice donor site probably null
R3439:Dnah10 UTSW 5 124,873,322 (GRCm39) missense possibly damaging 0.91
R3548:Dnah10 UTSW 5 124,824,694 (GRCm39) missense possibly damaging 0.50
R3881:Dnah10 UTSW 5 124,850,095 (GRCm39) missense probably benign 0.37
R4015:Dnah10 UTSW 5 124,854,990 (GRCm39) missense probably benign 0.25
R4261:Dnah10 UTSW 5 124,807,201 (GRCm39) missense possibly damaging 0.95
R4277:Dnah10 UTSW 5 124,809,394 (GRCm39) missense probably benign 0.28
R4299:Dnah10 UTSW 5 124,896,989 (GRCm39) missense probably damaging 1.00
R4613:Dnah10 UTSW 5 124,839,933 (GRCm39) splice site probably null
R4651:Dnah10 UTSW 5 124,806,207 (GRCm39) missense probably benign 0.20
R4652:Dnah10 UTSW 5 124,806,207 (GRCm39) missense probably benign 0.20
R4664:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4665:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4666:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4691:Dnah10 UTSW 5 124,852,581 (GRCm39) missense probably damaging 1.00
R4755:Dnah10 UTSW 5 124,824,809 (GRCm39) missense probably benign 0.01
R4806:Dnah10 UTSW 5 124,896,408 (GRCm39) missense probably damaging 1.00
R4839:Dnah10 UTSW 5 124,850,196 (GRCm39) missense probably damaging 1.00
R4903:Dnah10 UTSW 5 124,894,812 (GRCm39) missense probably damaging 1.00
R5018:Dnah10 UTSW 5 124,839,260 (GRCm39) missense possibly damaging 0.79
R5101:Dnah10 UTSW 5 124,909,577 (GRCm39) missense possibly damaging 0.51
R5105:Dnah10 UTSW 5 124,888,546 (GRCm39) missense probably benign 0.01
R5119:Dnah10 UTSW 5 124,856,322 (GRCm39) missense probably damaging 1.00
R5139:Dnah10 UTSW 5 124,876,024 (GRCm39) missense probably damaging 0.99
R5242:Dnah10 UTSW 5 124,864,484 (GRCm39) missense probably benign 0.00
R5262:Dnah10 UTSW 5 124,862,220 (GRCm39) missense probably damaging 1.00
R5277:Dnah10 UTSW 5 124,905,201 (GRCm39) missense probably damaging 1.00
R5293:Dnah10 UTSW 5 124,868,851 (GRCm39) missense probably benign 0.01
R5322:Dnah10 UTSW 5 124,850,630 (GRCm39) missense probably damaging 1.00
R5371:Dnah10 UTSW 5 124,820,693 (GRCm39) missense probably benign 0.16
R5468:Dnah10 UTSW 5 124,907,557 (GRCm39) missense probably damaging 1.00
R5470:Dnah10 UTSW 5 124,830,232 (GRCm39) missense probably benign
R5587:Dnah10 UTSW 5 124,870,977 (GRCm39) missense probably benign 0.10
R5724:Dnah10 UTSW 5 124,819,090 (GRCm39) missense probably benign 0.27
R5797:Dnah10 UTSW 5 124,898,450 (GRCm39) missense probably benign 0.00
R5812:Dnah10 UTSW 5 124,824,810 (GRCm39) missense probably benign 0.01
R5846:Dnah10 UTSW 5 124,900,437 (GRCm39) missense possibly damaging 0.80
R5930:Dnah10 UTSW 5 124,868,855 (GRCm39) critical splice donor site probably null
R5961:Dnah10 UTSW 5 124,888,546 (GRCm39) missense probably benign 0.01
R5970:Dnah10 UTSW 5 124,885,793 (GRCm39) missense probably benign
R6021:Dnah10 UTSW 5 124,814,048 (GRCm39) missense probably damaging 1.00
R6043:Dnah10 UTSW 5 124,878,924 (GRCm39) missense probably damaging 1.00
R6073:Dnah10 UTSW 5 124,896,274 (GRCm39) missense probably benign 0.09
R6080:Dnah10 UTSW 5 124,882,961 (GRCm39) missense possibly damaging 0.71
R6093:Dnah10 UTSW 5 124,830,238 (GRCm39) missense probably benign 0.18
R6155:Dnah10 UTSW 5 124,862,239 (GRCm39) missense probably damaging 1.00
R6155:Dnah10 UTSW 5 124,847,663 (GRCm39) missense probably damaging 1.00
R6162:Dnah10 UTSW 5 124,900,382 (GRCm39) missense probably benign 0.02
R6238:Dnah10 UTSW 5 124,820,743 (GRCm39) missense probably damaging 0.97
R6248:Dnah10 UTSW 5 124,871,283 (GRCm39) splice site probably null
R6275:Dnah10 UTSW 5 124,862,248 (GRCm39) missense probably damaging 1.00
R6297:Dnah10 UTSW 5 124,852,144 (GRCm39) missense possibly damaging 0.55
R6388:Dnah10 UTSW 5 124,906,710 (GRCm39) missense probably benign 0.00
R6458:Dnah10 UTSW 5 124,886,333 (GRCm39) missense probably damaging 1.00
R6504:Dnah10 UTSW 5 124,839,846 (GRCm39) missense possibly damaging 0.50
R6518:Dnah10 UTSW 5 124,835,419 (GRCm39) missense probably damaging 0.99
R6627:Dnah10 UTSW 5 124,907,097 (GRCm39) missense probably damaging 1.00
R6701:Dnah10 UTSW 5 124,837,223 (GRCm39) missense probably benign 0.45
R6702:Dnah10 UTSW 5 124,882,869 (GRCm39) missense probably damaging 1.00
R6745:Dnah10 UTSW 5 124,885,876 (GRCm39) missense probably damaging 1.00
R6784:Dnah10 UTSW 5 124,854,890 (GRCm39) missense probably damaging 0.99
R6807:Dnah10 UTSW 5 124,867,064 (GRCm39) splice site probably null
R6932:Dnah10 UTSW 5 124,898,514 (GRCm39) missense possibly damaging 0.75
R7007:Dnah10 UTSW 5 124,864,490 (GRCm39) missense probably damaging 1.00
R7091:Dnah10 UTSW 5 124,893,206 (GRCm39) missense probably benign 0.37
R7138:Dnah10 UTSW 5 124,900,009 (GRCm39) missense probably damaging 1.00
R7144:Dnah10 UTSW 5 124,900,006 (GRCm39) missense probably damaging 0.98
R7231:Dnah10 UTSW 5 124,890,892 (GRCm39) missense probably benign 0.19
R7278:Dnah10 UTSW 5 124,868,855 (GRCm39) critical splice donor site probably null
R7284:Dnah10 UTSW 5 124,909,662 (GRCm39) missense probably benign 0.37
R7322:Dnah10 UTSW 5 124,898,333 (GRCm39) missense probably benign 0.08
R7523:Dnah10 UTSW 5 124,824,803 (GRCm39) missense probably damaging 0.97
R7565:Dnah10 UTSW 5 124,876,095 (GRCm39) missense probably damaging 1.00
R7593:Dnah10 UTSW 5 124,823,608 (GRCm39) missense probably benign 0.21
R7606:Dnah10 UTSW 5 124,894,776 (GRCm39) missense probably benign 0.00
R7835:Dnah10 UTSW 5 124,854,298 (GRCm39) missense probably damaging 1.00
R7898:Dnah10 UTSW 5 124,859,425 (GRCm39) missense probably damaging 1.00
R7972:Dnah10 UTSW 5 124,803,949 (GRCm39) missense probably benign
R7999:Dnah10 UTSW 5 124,802,322 (GRCm39) missense probably benign 0.06
R8017:Dnah10 UTSW 5 124,877,949 (GRCm39) missense probably benign 0.03
R8032:Dnah10 UTSW 5 124,823,676 (GRCm39) missense probably damaging 0.98
R8052:Dnah10 UTSW 5 124,905,575 (GRCm39) missense probably benign 0.00
R8088:Dnah10 UTSW 5 124,831,330 (GRCm39) missense probably benign 0.00
R8169:Dnah10 UTSW 5 124,877,946 (GRCm39) missense probably damaging 1.00
R8178:Dnah10 UTSW 5 124,832,790 (GRCm39) missense probably benign 0.11
R8200:Dnah10 UTSW 5 124,905,524 (GRCm39) missense probably damaging 1.00
R8210:Dnah10 UTSW 5 124,827,858 (GRCm39) missense probably benign 0.29
R8294:Dnah10 UTSW 5 124,859,410 (GRCm39) missense probably damaging 1.00
R8338:Dnah10 UTSW 5 124,909,566 (GRCm39) missense probably damaging 1.00
R8404:Dnah10 UTSW 5 124,850,606 (GRCm39) missense probably damaging 1.00
R8469:Dnah10 UTSW 5 124,813,895 (GRCm39) missense probably damaging 1.00
R8537:Dnah10 UTSW 5 124,893,164 (GRCm39) missense probably damaging 0.97
R8701:Dnah10 UTSW 5 124,803,911 (GRCm39) missense probably benign 0.00
R8723:Dnah10 UTSW 5 124,891,685 (GRCm39) missense probably damaging 0.99
R8770:Dnah10 UTSW 5 124,852,410 (GRCm39) missense possibly damaging 0.94
R8838:Dnah10 UTSW 5 124,842,614 (GRCm39) missense probably benign 0.09
R8879:Dnah10 UTSW 5 124,895,181 (GRCm39) missense probably damaging 1.00
R8928:Dnah10 UTSW 5 124,866,828 (GRCm39) missense probably damaging 0.98
R8932:Dnah10 UTSW 5 124,878,015 (GRCm39) missense possibly damaging 0.96
R8945:Dnah10 UTSW 5 124,891,006 (GRCm39) missense probably damaging 0.99
R8990:Dnah10 UTSW 5 124,814,057 (GRCm39) missense
R9001:Dnah10 UTSW 5 124,852,515 (GRCm39) missense probably damaging 1.00
R9006:Dnah10 UTSW 5 124,820,783 (GRCm39) missense probably benign 0.23
R9060:Dnah10 UTSW 5 124,905,141 (GRCm39) missense probably damaging 1.00
R9085:Dnah10 UTSW 5 124,839,237 (GRCm39) missense
R9133:Dnah10 UTSW 5 124,859,423 (GRCm39) missense probably damaging 1.00
R9155:Dnah10 UTSW 5 124,907,475 (GRCm39) missense probably damaging 0.99
R9220:Dnah10 UTSW 5 124,871,437 (GRCm39) missense probably benign 0.05
R9234:Dnah10 UTSW 5 124,818,989 (GRCm39) missense possibly damaging 0.94
R9264:Dnah10 UTSW 5 124,813,900 (GRCm39) missense probably damaging 1.00
R9266:Dnah10 UTSW 5 124,845,990 (GRCm39) missense probably benign 0.00
R9386:Dnah10 UTSW 5 124,871,507 (GRCm39) critical splice donor site probably null
R9446:Dnah10 UTSW 5 124,823,677 (GRCm39) missense probably damaging 1.00
R9484:Dnah10 UTSW 5 124,900,508 (GRCm39) missense probably damaging 1.00
R9594:Dnah10 UTSW 5 124,907,107 (GRCm39) missense probably damaging 1.00
R9691:Dnah10 UTSW 5 124,852,249 (GRCm39) missense probably damaging 0.98
RF015:Dnah10 UTSW 5 124,895,141 (GRCm39) missense probably damaging 1.00
RF021:Dnah10 UTSW 5 124,854,971 (GRCm39) missense probably damaging 1.00
T0975:Dnah10 UTSW 5 124,840,130 (GRCm39) missense probably benign
U24488:Dnah10 UTSW 5 124,891,044 (GRCm39) missense probably damaging 1.00
X0017:Dnah10 UTSW 5 124,842,761 (GRCm39) missense probably benign 0.22
Z1176:Dnah10 UTSW 5 124,852,419 (GRCm39) missense probably benign 0.11
Z1177:Dnah10 UTSW 5 124,819,019 (GRCm39) missense probably damaging 1.00
Z1177:Dnah10 UTSW 5 124,895,052 (GRCm39) critical splice acceptor site probably null
Z1177:Dnah10 UTSW 5 124,824,683 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GGGGCATCAAGCGAACTTTCACAG -3'
(R):5'- GGCTACACTGGCAAAGGCTGATTTC -3'

Sequencing Primer
(F):5'- TCACCTCTGAGCGCAGATG -3'
(R):5'- GTAGACCAGGGTTCCAACCTTC -3'
Posted On 2014-03-28