Incidental Mutation 'R1466:Akap13'
ID 166049
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene Name A kinase anchor protein 13
Synonyms PROTO-LB, Ht31, 5830460E08Rik, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, AKAP-Lbc
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1466 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 75105282-75404357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75378797 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2095 (S2095P)
Ref Sequence ENSEMBL: ENSMUSP00000129784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207239] [ENSMUST00000207750]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094307
AA Change: S394P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000091865
Gene: ENSMUSG00000066406
AA Change: S394P

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
C1 54 100 1.95e-4 SMART
low complexity region 157 168 N/A INTRINSIC
RhoGEF 260 452 1.28e-61 SMART
PH 494 597 2.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147005
AA Change: S2113P

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: S2113P

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
internal_repeat_1 485 695 4.85e-5 PROSPERO
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
Pfam:RII_binding_1 1218 1235 4.3e-6 PFAM
low complexity region 1429 1444 N/A INTRINSIC
low complexity region 1479 1501 N/A INTRINSIC
low complexity region 1601 1612 N/A INTRINSIC
low complexity region 1738 1768 N/A INTRINSIC
C1 1773 1819 1.95e-4 SMART
low complexity region 1876 1887 N/A INTRINSIC
RhoGEF 1979 2171 1.28e-61 SMART
PH 2213 2316 2.94e-11 SMART
coiled coil region 2326 2363 N/A INTRINSIC
low complexity region 2411 2430 N/A INTRINSIC
low complexity region 2462 2472 N/A INTRINSIC
coiled coil region 2551 2664 N/A INTRINSIC
low complexity region 2746 2752 N/A INTRINSIC
low complexity region 2758 2771 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166315
AA Change: S2095P

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: S2095P

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207239
AA Change: S394P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000207750
AA Change: S2113P

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1972 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
Adamts12 T C 15: 11,311,445 (GRCm39) F1234S probably benign Het
Ahnak A G 19: 8,993,239 (GRCm39) D4841G probably damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arhgef17 G T 7: 100,578,866 (GRCm39) P694Q possibly damaging Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Aspg A G 12: 112,088,286 (GRCm39) N385D probably benign Het
Atxn3 G A 12: 101,892,758 (GRCm39) R319C possibly damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
C1s1 C T 6: 124,508,090 (GRCm39) C633Y probably damaging Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Cbl A T 9: 44,065,541 (GRCm39) V706E probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cfhr1 C T 1: 139,485,312 (GRCm39) E45K probably benign Het
Chd7 G A 4: 8,840,561 (GRCm39) probably null Het
Chek1 G T 9: 36,637,153 (GRCm39) A2E probably damaging Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Crb2 T C 2: 37,673,400 (GRCm39) Y99H probably damaging Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Cym G A 3: 107,120,774 (GRCm39) T277I probably damaging Het
Cyp2d11 C T 15: 82,275,936 (GRCm39) C215Y probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dnah10 T A 5: 124,840,160 (GRCm39) Y1265N probably benign Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Efhb A G 17: 53,744,206 (GRCm39) F462L probably damaging Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Fat3 A C 9: 16,286,778 (GRCm39) V915G probably damaging Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Galnt4 A G 10: 98,944,571 (GRCm39) R99G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Gm10110 A T 14: 90,135,511 (GRCm39) noncoding transcript Het
Gm4884 A G 7: 40,692,552 (GRCm39) K174E probably damaging Het
Grip2 A T 6: 91,765,424 (GRCm39) D19E probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T A 8: 111,259,585 (GRCm39) V2519E possibly damaging Het
Ints11 G A 4: 155,972,567 (GRCm39) probably null Het
Kif1a A G 1: 92,982,651 (GRCm39) W718R possibly damaging Het
Kif1b A T 4: 149,307,709 (GRCm39) Y839N probably damaging Het
Kif20b T A 19: 34,927,999 (GRCm39) V1047D probably benign Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Klra10 T A 6: 130,256,278 (GRCm39) R125S probably damaging Het
Klra10 T C 6: 130,256,394 (GRCm39) N87D probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Map4k2 G T 19: 6,391,947 (GRCm39) W87L probably damaging Het
Mccc1 A G 3: 36,028,435 (GRCm39) V457A probably benign Het
Mdn1 T A 4: 32,730,788 (GRCm39) S2886T probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrpl24 T A 3: 87,829,235 (GRCm39) Y21* probably null Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Mtcl1 T A 17: 66,687,430 (GRCm39) D492V probably damaging Het
Muc2 A G 7: 141,302,711 (GRCm39) Y457C probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Myg1 T A 15: 102,245,825 (GRCm39) L275Q probably damaging Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or12d13 A T 17: 37,647,847 (GRCm39) L92H probably benign Het
Or13a18 A G 7: 140,190,882 (GRCm39) I268V probably benign Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pcdh10 T G 3: 45,334,409 (GRCm39) L241R probably damaging Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Ppef1 C A X: 159,408,670 (GRCm39) probably null Het
Prkaa1 C A 15: 5,208,279 (GRCm39) P507T probably benign Het
Ptch1 A G 13: 63,672,783 (GRCm39) Y804H probably benign Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rfx5 T A 3: 94,863,614 (GRCm39) Y88N probably damaging Het
Rnase2b A T 14: 51,400,296 (GRCm39) K126* probably null Het
Rpl3l A G 17: 24,949,845 (GRCm39) I15V probably benign Het
Saal1 G T 7: 46,351,969 (GRCm39) probably null Het
Sbpl A C 17: 24,172,228 (GRCm39) D230E unknown Het
Scn10a T C 9: 119,495,556 (GRCm39) Y322C probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc25a36 A G 9: 96,962,408 (GRCm39) F194L probably damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Slc7a11 G T 3: 50,335,522 (GRCm39) probably null Het
Slco4c1 A T 1: 96,768,897 (GRCm39) S322T probably damaging Het
Smarcc2 A T 10: 128,310,114 (GRCm39) T376S probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Syp A T X: 7,514,944 (GRCm39) probably benign Het
Tas1r2 A G 4: 139,396,722 (GRCm39) D687G probably damaging Het
Tekt4 A T 17: 25,691,048 (GRCm39) Q118L probably benign Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tph2 T C 10: 114,915,600 (GRCm39) N480S probably benign Het
Tsc2 A T 17: 24,827,947 (GRCm39) M839K probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Uaca C T 9: 60,761,603 (GRCm39) A205V possibly damaging Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Zfp704 G T 3: 9,512,408 (GRCm39) T288N possibly damaging Het
Zfp93 T C 7: 23,975,521 (GRCm39) V502A probably damaging Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75,375,719 (GRCm39) missense probably damaging 0.99
IGL00332:Akap13 APN 7 75,378,667 (GRCm39) missense probably damaging 1.00
IGL00481:Akap13 APN 7 75,373,643 (GRCm39) missense probably damaging 1.00
IGL00590:Akap13 APN 7 75,260,417 (GRCm39) missense probably benign 0.01
IGL00655:Akap13 APN 7 75,354,146 (GRCm39) missense probably damaging 0.99
IGL00766:Akap13 APN 7 75,354,260 (GRCm39) missense probably damaging 0.96
IGL00818:Akap13 APN 7 75,259,475 (GRCm39) missense probably benign 0.00
IGL00826:Akap13 APN 7 75,327,195 (GRCm39) missense probably damaging 1.00
IGL01014:Akap13 APN 7 75,400,381 (GRCm39) utr 3 prime probably benign
IGL01090:Akap13 APN 7 75,316,279 (GRCm39) missense probably benign 0.44
IGL01155:Akap13 APN 7 75,219,684 (GRCm39) missense probably damaging 1.00
IGL01326:Akap13 APN 7 75,375,096 (GRCm39) missense probably benign 0.30
IGL01456:Akap13 APN 7 75,252,595 (GRCm39) missense probably damaging 0.98
IGL01460:Akap13 APN 7 75,397,594 (GRCm39) missense probably benign 0.29
IGL01568:Akap13 APN 7 75,258,270 (GRCm39) nonsense probably null 0.00
IGL01610:Akap13 APN 7 75,397,353 (GRCm39) missense probably damaging 1.00
IGL01610:Akap13 APN 7 75,369,928 (GRCm39) missense possibly damaging 0.71
IGL01615:Akap13 APN 7 75,347,141 (GRCm39) missense probably damaging 1.00
IGL01667:Akap13 APN 7 75,219,767 (GRCm39) missense probably damaging 1.00
IGL01705:Akap13 APN 7 75,396,515 (GRCm39) missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75,316,293 (GRCm39) missense probably benign 0.27
IGL02269:Akap13 APN 7 75,252,659 (GRCm39) missense probably benign
IGL02421:Akap13 APN 7 75,367,554 (GRCm39) missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75,258,936 (GRCm39) missense probably damaging 0.96
IGL02944:Akap13 APN 7 75,258,405 (GRCm39) missense probably benign
IGL03051:Akap13 APN 7 75,260,233 (GRCm39) nonsense probably null
IGL03160:Akap13 APN 7 75,380,165 (GRCm39) missense probably damaging 1.00
IGL03245:Akap13 APN 7 75,259,500 (GRCm39) missense probably damaging 0.99
R0254:Akap13 UTSW 7 75,386,352 (GRCm39) splice site probably benign
R0310:Akap13 UTSW 7 75,264,678 (GRCm39) missense probably damaging 0.99
R0373:Akap13 UTSW 7 75,380,248 (GRCm39) missense probably damaging 1.00
R0373:Akap13 UTSW 7 75,259,677 (GRCm39) missense probably benign 0.00
R0408:Akap13 UTSW 7 75,396,544 (GRCm39) missense probably damaging 1.00
R0631:Akap13 UTSW 7 75,264,744 (GRCm39) missense probably damaging 0.99
R0646:Akap13 UTSW 7 75,397,494 (GRCm39) missense probably damaging 1.00
R0781:Akap13 UTSW 7 75,261,125 (GRCm39) missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75,375,128 (GRCm39) missense probably damaging 1.00
R1004:Akap13 UTSW 7 75,337,034 (GRCm39) missense probably damaging 0.99
R1024:Akap13 UTSW 7 75,327,157 (GRCm39) missense probably damaging 1.00
R1110:Akap13 UTSW 7 75,261,125 (GRCm39) missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75,235,941 (GRCm39) missense probably damaging 0.97
R1442:Akap13 UTSW 7 75,385,526 (GRCm39) missense probably damaging 0.99
R1466:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75,326,942 (GRCm39) missense probably damaging 1.00
R1773:Akap13 UTSW 7 75,333,199 (GRCm39) missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R1786:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R1791:Akap13 UTSW 7 75,260,783 (GRCm39) missense probably benign 0.00
R1819:Akap13 UTSW 7 75,258,453 (GRCm39) missense probably benign 0.04
R1879:Akap13 UTSW 7 75,260,475 (GRCm39) missense probably benign 0.01
R1989:Akap13 UTSW 7 75,354,264 (GRCm39) missense probably benign 0.01
R2016:Akap13 UTSW 7 75,354,279 (GRCm39) missense probably damaging 0.99
R2092:Akap13 UTSW 7 75,260,318 (GRCm39) missense probably benign 0.05
R2126:Akap13 UTSW 7 75,375,052 (GRCm39) missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2132:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2133:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2251:Akap13 UTSW 7 75,389,225 (GRCm39) missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75,316,298 (GRCm39) missense probably damaging 1.00
R3713:Akap13 UTSW 7 75,235,929 (GRCm39) missense probably damaging 0.98
R3731:Akap13 UTSW 7 75,261,125 (GRCm39) missense probably benign 0.39
R3765:Akap13 UTSW 7 75,258,585 (GRCm39) missense probably benign 0.04
R3788:Akap13 UTSW 7 75,351,901 (GRCm39) critical splice donor site probably null
R3793:Akap13 UTSW 7 75,259,889 (GRCm39) missense probably benign 0.00
R3970:Akap13 UTSW 7 75,219,699 (GRCm39) nonsense probably null
R4205:Akap13 UTSW 7 75,260,667 (GRCm39) missense probably benign 0.05
R4257:Akap13 UTSW 7 75,261,033 (GRCm39) missense probably damaging 0.98
R4374:Akap13 UTSW 7 75,258,732 (GRCm39) missense probably damaging 0.96
R4448:Akap13 UTSW 7 75,392,508 (GRCm39) missense probably damaging 1.00
R4450:Akap13 UTSW 7 75,392,508 (GRCm39) missense probably damaging 1.00
R4457:Akap13 UTSW 7 75,389,213 (GRCm39) missense probably damaging 0.99
R4458:Akap13 UTSW 7 75,389,213 (GRCm39) missense probably damaging 0.99
R4466:Akap13 UTSW 7 75,252,521 (GRCm39) splice site probably null
R4632:Akap13 UTSW 7 75,316,301 (GRCm39) missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75,378,842 (GRCm39) missense probably damaging 1.00
R4669:Akap13 UTSW 7 75,378,842 (GRCm39) missense probably damaging 1.00
R4671:Akap13 UTSW 7 75,229,312 (GRCm39) nonsense probably null
R4821:Akap13 UTSW 7 75,327,255 (GRCm39) intron probably benign
R4868:Akap13 UTSW 7 75,393,252 (GRCm39) missense probably damaging 1.00
R4894:Akap13 UTSW 7 75,375,068 (GRCm39) missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75,398,988 (GRCm39) missense probably benign 0.22
R4962:Akap13 UTSW 7 75,399,178 (GRCm39) missense probably damaging 0.98
R4988:Akap13 UTSW 7 75,380,276 (GRCm39) missense probably damaging 1.00
R5119:Akap13 UTSW 7 75,337,000 (GRCm39) missense probably damaging 0.98
R5141:Akap13 UTSW 7 75,259,362 (GRCm39) missense probably benign 0.18
R5419:Akap13 UTSW 7 75,259,991 (GRCm39) missense probably benign 0.01
R5427:Akap13 UTSW 7 75,378,617 (GRCm39) missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75,252,652 (GRCm39) missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75,252,578 (GRCm39) missense probably damaging 1.00
R5458:Akap13 UTSW 7 75,236,049 (GRCm39) missense probably damaging 1.00
R5636:Akap13 UTSW 7 75,354,120 (GRCm39) missense probably damaging 0.96
R5643:Akap13 UTSW 7 75,351,902 (GRCm39) critical splice donor site probably null
R5898:Akap13 UTSW 7 75,378,894 (GRCm39) missense probably damaging 1.00
R5932:Akap13 UTSW 7 75,259,932 (GRCm39) missense probably damaging 1.00
R6135:Akap13 UTSW 7 75,259,656 (GRCm39) missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75,327,164 (GRCm39) missense probably damaging 1.00
R6182:Akap13 UTSW 7 75,236,028 (GRCm39) missense probably benign 0.45
R6310:Akap13 UTSW 7 75,398,941 (GRCm39) missense probably damaging 0.99
R6346:Akap13 UTSW 7 75,335,002 (GRCm39) missense probably damaging 1.00
R6466:Akap13 UTSW 7 75,376,792 (GRCm39) missense probably benign 0.01
R6605:Akap13 UTSW 7 75,229,516 (GRCm39) missense probably damaging 0.98
R6617:Akap13 UTSW 7 75,380,111 (GRCm39) missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75,219,729 (GRCm39) missense probably damaging 1.00
R6703:Akap13 UTSW 7 75,252,646 (GRCm39) missense probably damaging 1.00
R6750:Akap13 UTSW 7 75,389,206 (GRCm39) missense probably benign 0.03
R7069:Akap13 UTSW 7 75,260,010 (GRCm39) missense probably benign 0.29
R7116:Akap13 UTSW 7 75,369,943 (GRCm39) missense probably benign 0.00
R7158:Akap13 UTSW 7 75,229,342 (GRCm39) missense probably damaging 0.97
R7159:Akap13 UTSW 7 75,380,327 (GRCm39) missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7468:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7471:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7472:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7477:Akap13 UTSW 7 75,398,995 (GRCm39) missense probably benign
R7636:Akap13 UTSW 7 75,259,621 (GRCm39) missense probably benign 0.04
R7650:Akap13 UTSW 7 75,293,202 (GRCm39) missense probably benign 0.20
R7671:Akap13 UTSW 7 75,219,648 (GRCm39) missense probably damaging 1.00
R7681:Akap13 UTSW 7 75,378,544 (GRCm39) missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75,327,006 (GRCm39) missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75,260,076 (GRCm39) missense probably benign 0.00
R7816:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7817:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7834:Akap13 UTSW 7 75,392,390 (GRCm39) missense possibly damaging 0.85
R7880:Akap13 UTSW 7 75,235,964 (GRCm39) missense probably damaging 0.97
R7942:Akap13 UTSW 7 75,261,218 (GRCm39) missense possibly damaging 0.50
R8006:Akap13 UTSW 7 75,229,444 (GRCm39) missense probably damaging 1.00
R8009:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8011:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8012:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8013:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8016:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8089:Akap13 UTSW 7 75,260,340 (GRCm39) missense possibly damaging 0.94
R8138:Akap13 UTSW 7 75,351,979 (GRCm39) splice site probably null
R8174:Akap13 UTSW 7 75,378,617 (GRCm39) missense possibly damaging 0.89
R8298:Akap13 UTSW 7 75,397,552 (GRCm39) missense probably damaging 1.00
R8444:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8445:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8465:Akap13 UTSW 7 75,376,786 (GRCm39) missense probably benign 0.11
R8512:Akap13 UTSW 7 75,260,834 (GRCm39) missense probably damaging 0.99
R8523:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8793:Akap13 UTSW 7 75,375,076 (GRCm39) missense probably benign 0.35
R8907:Akap13 UTSW 7 75,260,456 (GRCm39) missense probably damaging 0.99
R8907:Akap13 UTSW 7 75,260,444 (GRCm39) missense probably benign 0.08
R8928:Akap13 UTSW 7 75,259,606 (GRCm39) missense probably benign 0.00
R8929:Akap13 UTSW 7 75,258,752 (GRCm39) missense probably benign 0.00
R8937:Akap13 UTSW 7 75,184,601 (GRCm39) critical splice donor site probably null
R8967:Akap13 UTSW 7 75,378,882 (GRCm39) missense possibly damaging 0.80
R8986:Akap13 UTSW 7 75,259,074 (GRCm39) missense probably benign
R9152:Akap13 UTSW 7 75,261,033 (GRCm39) missense probably damaging 0.98
R9153:Akap13 UTSW 7 75,259,229 (GRCm39) missense probably benign 0.00
R9160:Akap13 UTSW 7 75,385,526 (GRCm39) missense possibly damaging 0.88
R9192:Akap13 UTSW 7 75,354,249 (GRCm39) missense probably benign 0.06
R9319:Akap13 UTSW 7 75,258,836 (GRCm39) missense probably benign 0.01
R9513:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9515:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9516:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9523:Akap13 UTSW 7 75,293,193 (GRCm39) missense
R9564:Akap13 UTSW 7 75,259,161 (GRCm39) missense probably benign
R9621:Akap13 UTSW 7 75,386,090 (GRCm39) missense probably benign 0.09
R9686:Akap13 UTSW 7 75,236,084 (GRCm39) missense probably damaging 1.00
Z1176:Akap13 UTSW 7 75,380,300 (GRCm39) missense probably damaging 0.99
Z1177:Akap13 UTSW 7 75,264,753 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCAAGTTCTGTGGACAGCACAACC -3'
(R):5'- GTGCCTCAACACCTGTAATCTCAGC -3'

Sequencing Primer
(F):5'- GTCTGTCAACTACTTCAAAGACCTC -3'
(R):5'- gcactttttttgtttgtttgtttttc -3'
Posted On 2014-03-28