Incidental Mutation 'R1466:Akap13'
ID 166049
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene Name A kinase (PRKA) anchor protein 13
Synonyms AKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1466 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 75455534-75754609 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75729049 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2095 (S2095P)
Ref Sequence ENSEMBL: ENSMUSP00000129784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207239] [ENSMUST00000207750]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094307
AA Change: S394P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000091865
Gene: ENSMUSG00000066406
AA Change: S394P

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
C1 54 100 1.95e-4 SMART
low complexity region 157 168 N/A INTRINSIC
RhoGEF 260 452 1.28e-61 SMART
PH 494 597 2.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147005
AA Change: S2113P

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: S2113P

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
internal_repeat_1 485 695 4.85e-5 PROSPERO
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
Pfam:RII_binding_1 1218 1235 4.3e-6 PFAM
low complexity region 1429 1444 N/A INTRINSIC
low complexity region 1479 1501 N/A INTRINSIC
low complexity region 1601 1612 N/A INTRINSIC
low complexity region 1738 1768 N/A INTRINSIC
C1 1773 1819 1.95e-4 SMART
low complexity region 1876 1887 N/A INTRINSIC
RhoGEF 1979 2171 1.28e-61 SMART
PH 2213 2316 2.94e-11 SMART
coiled coil region 2326 2363 N/A INTRINSIC
low complexity region 2411 2430 N/A INTRINSIC
low complexity region 2462 2472 N/A INTRINSIC
coiled coil region 2551 2664 N/A INTRINSIC
low complexity region 2746 2752 N/A INTRINSIC
low complexity region 2758 2771 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166315
AA Change: S2095P

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: S2095P

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207239
AA Change: S394P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000207750
AA Change: S2113P

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1972 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
Adamts12 T C 15: 11,311,359 F1234S probably benign Het
Ahnak A G 19: 9,015,875 D4841G probably damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arhgef17 G T 7: 100,929,659 P694Q possibly damaging Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
Aspg A G 12: 112,121,852 N385D probably benign Het
Atxn3 G A 12: 101,926,499 R319C possibly damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
C1s1 C T 6: 124,531,131 C633Y probably damaging Het
C8g C T 2: 25,500,216 A6T probably benign Het
Cbl A T 9: 44,154,244 V706E probably benign Het
Cfhr1 C T 1: 139,557,574 E45K probably benign Het
Chd7 G A 4: 8,840,561 probably null Het
Chek1 G T 9: 36,725,857 A2E probably damaging Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Corin C T 5: 72,302,790 probably null Het
Crb2 T C 2: 37,783,388 Y99H probably damaging Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Cym G A 3: 107,213,458 T277I probably damaging Het
Cyp2d11 C T 15: 82,391,735 C215Y probably benign Het
Dido1 G A 2: 180,662,328 P1261L probably damaging Het
Dnah10 T A 5: 124,763,096 Y1265N probably benign Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Efhb A G 17: 53,437,178 F462L probably damaging Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Fat3 A C 9: 16,375,482 V915G probably damaging Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Galnt4 A G 10: 99,108,709 R99G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Glcci1 C T 6: 8,537,964 T6I probably damaging Het
Gm10110 A T 14: 89,898,075 noncoding transcript Het
Gm4884 A G 7: 41,043,128 K174E probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grip2 A T 6: 91,788,443 D19E probably damaging Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T A 8: 110,532,953 V2519E possibly damaging Het
Ints11 G A 4: 155,888,110 probably null Het
Kif1a A G 1: 93,054,929 W718R possibly damaging Het
Kif1b A T 4: 149,223,252 Y839N probably damaging Het
Kif20b T A 19: 34,950,599 V1047D probably benign Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Klra10 T A 6: 130,279,315 R125S probably damaging Het
Klra10 T C 6: 130,279,431 N87D probably damaging Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Map4k2 G T 19: 6,341,917 W87L probably damaging Het
Mccc1 A G 3: 35,974,286 V457A probably benign Het
Mdn1 T A 4: 32,730,788 S2886T probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mrpl24 T A 3: 87,921,928 Y21* probably null Het
Mrps35 C T 6: 147,055,984 T169M probably damaging Het
Mtcl1 T A 17: 66,380,435 D492V probably damaging Het
Muc2 A G 7: 141,748,974 Y457C probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Myg1 T A 15: 102,337,390 L275Q probably damaging Het
Naga T A 15: 82,334,788 M237L probably null Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 F251I probably damaging Het
Olfr103 A T 17: 37,336,956 L92H probably benign Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr46 A G 7: 140,610,969 I268V probably benign Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pcdh10 T G 3: 45,379,974 L241R probably damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Ppef1 C A X: 160,625,674 probably null Het
Prkaa1 C A 15: 5,178,798 P507T probably benign Het
Ptch1 A G 13: 63,524,969 Y804H probably benign Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rfx5 T A 3: 94,956,303 Y88N probably damaging Het
Rnase2b A T 14: 51,162,839 K126* probably null Het
Rpl3l A G 17: 24,730,871 I15V probably benign Het
Saal1 G T 7: 46,702,545 probably null Het
Sbpl A C 17: 23,953,254 D230E unknown Het
Scn10a T C 9: 119,666,490 Y322C probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc25a36 A G 9: 97,080,355 F194L probably damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc7a11 G T 3: 50,381,073 probably null Het
Slco4c1 A T 1: 96,841,172 S322T probably damaging Het
Smarcc2 A T 10: 128,474,245 T376S probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
St3gal3 A C 4: 118,107,662 M1R probably null Het
Syp A T X: 7,648,705 probably benign Het
Tas1r2 A G 4: 139,669,411 D687G probably damaging Het
Tekt4 A T 17: 25,472,074 Q118L probably benign Het
Tph2 T C 10: 115,079,695 N480S probably benign Het
Tsc2 A T 17: 24,608,973 M839K probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Uaca C T 9: 60,854,321 A205V possibly damaging Het
Uhmk1 A T 1: 170,208,653 probably null Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Zfp704 G T 3: 9,447,348 T288N possibly damaging Het
Zfp93 T C 7: 24,276,096 V502A probably damaging Het
Zzef1 C T 11: 72,924,679 P2942S probably damaging Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75725971 missense probably damaging 0.99
IGL00332:Akap13 APN 7 75728919 missense probably damaging 1.00
IGL00481:Akap13 APN 7 75723895 missense probably damaging 1.00
IGL00590:Akap13 APN 7 75610669 missense probably benign 0.01
IGL00655:Akap13 APN 7 75704398 missense probably damaging 0.99
IGL00766:Akap13 APN 7 75704512 missense probably damaging 0.96
IGL00818:Akap13 APN 7 75609727 missense probably benign 0.00
IGL00826:Akap13 APN 7 75677447 missense probably damaging 1.00
IGL01014:Akap13 APN 7 75750633 utr 3 prime probably benign
IGL01090:Akap13 APN 7 75666531 missense probably benign 0.44
IGL01155:Akap13 APN 7 75569936 missense probably damaging 1.00
IGL01326:Akap13 APN 7 75725348 missense probably benign 0.30
IGL01456:Akap13 APN 7 75602847 missense probably damaging 0.98
IGL01460:Akap13 APN 7 75747846 missense probably benign 0.29
IGL01568:Akap13 APN 7 75608522 nonsense probably null 0.00
IGL01610:Akap13 APN 7 75720180 missense possibly damaging 0.71
IGL01610:Akap13 APN 7 75747605 missense probably damaging 1.00
IGL01615:Akap13 APN 7 75697393 missense probably damaging 1.00
IGL01667:Akap13 APN 7 75570019 missense probably damaging 1.00
IGL01705:Akap13 APN 7 75746767 missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75666545 missense probably benign 0.27
IGL02269:Akap13 APN 7 75602911 missense probably benign
IGL02421:Akap13 APN 7 75717806 missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75609188 missense probably damaging 0.96
IGL02944:Akap13 APN 7 75608657 missense probably benign
IGL03051:Akap13 APN 7 75610485 nonsense probably null
IGL03160:Akap13 APN 7 75730417 missense probably damaging 1.00
IGL03245:Akap13 APN 7 75609752 missense probably damaging 0.99
R0254:Akap13 UTSW 7 75736604 splice site probably benign
R0310:Akap13 UTSW 7 75614930 missense probably damaging 0.99
R0373:Akap13 UTSW 7 75609929 missense probably benign 0.00
R0373:Akap13 UTSW 7 75730500 missense probably damaging 1.00
R0408:Akap13 UTSW 7 75746796 missense probably damaging 1.00
R0631:Akap13 UTSW 7 75614996 missense probably damaging 0.99
R0646:Akap13 UTSW 7 75747746 missense probably damaging 1.00
R0781:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75725380 missense probably damaging 1.00
R1004:Akap13 UTSW 7 75687286 missense probably damaging 0.99
R1024:Akap13 UTSW 7 75677409 missense probably damaging 1.00
R1110:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75586193 missense probably damaging 0.97
R1442:Akap13 UTSW 7 75735778 missense probably damaging 0.99
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75677194 missense probably damaging 1.00
R1773:Akap13 UTSW 7 75683451 missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1786:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1791:Akap13 UTSW 7 75611035 missense probably benign 0.00
R1819:Akap13 UTSW 7 75608705 missense probably benign 0.04
R1879:Akap13 UTSW 7 75610727 missense probably benign 0.01
R1989:Akap13 UTSW 7 75704516 missense probably benign 0.01
R2016:Akap13 UTSW 7 75704531 missense probably damaging 0.99
R2092:Akap13 UTSW 7 75610570 missense probably benign 0.05
R2126:Akap13 UTSW 7 75725304 missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2132:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2133:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2251:Akap13 UTSW 7 75739477 missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75666550 missense probably damaging 1.00
R3713:Akap13 UTSW 7 75586181 missense probably damaging 0.98
R3731:Akap13 UTSW 7 75611377 missense probably benign 0.39
R3765:Akap13 UTSW 7 75608837 missense probably benign 0.04
R3788:Akap13 UTSW 7 75702153 critical splice donor site probably null
R3793:Akap13 UTSW 7 75610141 missense probably benign 0.00
R3970:Akap13 UTSW 7 75569951 nonsense probably null
R4205:Akap13 UTSW 7 75610919 missense probably benign 0.05
R4257:Akap13 UTSW 7 75611285 missense probably damaging 0.98
R4374:Akap13 UTSW 7 75608984 missense probably damaging 0.96
R4448:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4450:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4457:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4458:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4466:Akap13 UTSW 7 75602773 splice site probably null
R4632:Akap13 UTSW 7 75666553 missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4669:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4671:Akap13 UTSW 7 75579564 nonsense probably null
R4821:Akap13 UTSW 7 75677507 intron probably benign
R4868:Akap13 UTSW 7 75743504 missense probably damaging 1.00
R4894:Akap13 UTSW 7 75725320 missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75749240 missense probably benign 0.22
R4962:Akap13 UTSW 7 75749430 missense probably damaging 0.98
R4988:Akap13 UTSW 7 75730528 missense probably damaging 1.00
R5119:Akap13 UTSW 7 75687252 missense probably damaging 0.98
R5141:Akap13 UTSW 7 75609614 missense probably benign 0.18
R5419:Akap13 UTSW 7 75610243 missense probably benign 0.01
R5427:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75602904 missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75602830 missense probably damaging 1.00
R5458:Akap13 UTSW 7 75586301 missense probably damaging 1.00
R5636:Akap13 UTSW 7 75704372 missense probably damaging 0.96
R5643:Akap13 UTSW 7 75702154 critical splice donor site probably null
R5898:Akap13 UTSW 7 75729146 missense probably damaging 1.00
R5932:Akap13 UTSW 7 75610184 missense probably damaging 1.00
R6135:Akap13 UTSW 7 75609908 missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75677416 missense probably damaging 1.00
R6182:Akap13 UTSW 7 75586280 missense probably benign 0.45
R6310:Akap13 UTSW 7 75749193 missense probably damaging 0.99
R6346:Akap13 UTSW 7 75685254 missense probably damaging 1.00
R6466:Akap13 UTSW 7 75727044 missense probably benign 0.01
R6605:Akap13 UTSW 7 75579768 missense probably damaging 0.98
R6617:Akap13 UTSW 7 75730363 missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75569981 missense probably damaging 1.00
R6703:Akap13 UTSW 7 75602898 missense probably damaging 1.00
R6750:Akap13 UTSW 7 75739458 missense probably benign 0.03
R7069:Akap13 UTSW 7 75610262 missense probably benign 0.29
R7116:Akap13 UTSW 7 75720195 missense probably benign 0.00
R7158:Akap13 UTSW 7 75579594 missense probably damaging 0.97
R7159:Akap13 UTSW 7 75730579 missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7468:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7471:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7472:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7477:Akap13 UTSW 7 75749247 missense probably benign
R7636:Akap13 UTSW 7 75609873 missense probably benign 0.04
R7650:Akap13 UTSW 7 75643454 missense probably benign 0.20
R7671:Akap13 UTSW 7 75569900 missense probably damaging 1.00
R7681:Akap13 UTSW 7 75728796 missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75677258 missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75610328 missense probably benign 0.00
R7816:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7817:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7834:Akap13 UTSW 7 75742642 missense possibly damaging 0.85
R7880:Akap13 UTSW 7 75586216 missense probably damaging 0.97
R7942:Akap13 UTSW 7 75611470 missense possibly damaging 0.50
R8006:Akap13 UTSW 7 75579696 missense probably damaging 1.00
R8009:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8011:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8012:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8013:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8016:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8089:Akap13 UTSW 7 75610592 missense possibly damaging 0.94
R8138:Akap13 UTSW 7 75702231 splice site probably null
R8174:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R8298:Akap13 UTSW 7 75747804 missense probably damaging 1.00
R8444:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8445:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8465:Akap13 UTSW 7 75727038 missense probably benign 0.11
R8512:Akap13 UTSW 7 75611086 missense probably damaging 0.99
R8523:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8793:Akap13 UTSW 7 75725328 missense probably benign 0.35
R8907:Akap13 UTSW 7 75610696 missense probably benign 0.08
R8907:Akap13 UTSW 7 75610708 missense probably damaging 0.99
R8928:Akap13 UTSW 7 75609858 missense probably benign 0.00
R8929:Akap13 UTSW 7 75609004 missense probably benign 0.00
R8937:Akap13 UTSW 7 75534853 critical splice donor site probably null
R8967:Akap13 UTSW 7 75729134 missense possibly damaging 0.80
R8986:Akap13 UTSW 7 75609326 missense probably benign
R9152:Akap13 UTSW 7 75611285 missense probably damaging 0.98
R9153:Akap13 UTSW 7 75609481 missense probably benign 0.00
R9160:Akap13 UTSW 7 75735778 missense possibly damaging 0.88
R9192:Akap13 UTSW 7 75704501 missense probably benign 0.06
R9319:Akap13 UTSW 7 75609088 missense probably benign 0.01
R9513:Akap13 UTSW 7 75704527 missense probably benign 0.01
R9515:Akap13 UTSW 7 75704527 missense probably benign 0.01
R9516:Akap13 UTSW 7 75704527 missense probably benign 0.01
R9523:Akap13 UTSW 7 75643445 missense
R9564:Akap13 UTSW 7 75609413 missense probably benign
R9621:Akap13 UTSW 7 75736342 missense probably benign 0.09
R9686:Akap13 UTSW 7 75586336 missense probably damaging 1.00
Z1176:Akap13 UTSW 7 75730552 missense probably damaging 0.99
Z1177:Akap13 UTSW 7 75615005 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCAAGTTCTGTGGACAGCACAACC -3'
(R):5'- GTGCCTCAACACCTGTAATCTCAGC -3'

Sequencing Primer
(F):5'- GTCTGTCAACTACTTCAAAGACCTC -3'
(R):5'- gcactttttttgtttgtttgtttttc -3'
Posted On 2014-03-28