Incidental Mutation 'R1466:Fat3'
ID 166061
Institutional Source Beutler Lab
Gene Symbol Fat3
Ensembl Gene ENSMUSG00000074505
Gene Name FAT atypical cadherin 3
Synonyms 9430076A06Rik, D430038H04Rik, LOC382129, LOC234973
Accession Numbers

Genbank: NM_001080814; MGI: 2444314

Essential gene? Possibly non essential (E-score: 0.417) question?
Stock # R1466 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 15910189-16501285 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 16375482 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 915 (V915G)
Ref Sequence ENSEMBL: ENSMUSP00000148968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082170] [ENSMUST00000217308]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000082170
AA Change: V915G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080808
Gene: ENSMUSG00000074505
AA Change: V915G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 65 151 3e-7 SMART
CA 175 259 8.9e-22 SMART
CA 280 368 8.9e-4 SMART
CA 389 465 2.6e-11 SMART
CA 489 571 2e-29 SMART
low complexity region 684 697 N/A INTRINSIC
CA 743 824 1e-24 SMART
low complexity region 830 840 N/A INTRINSIC
CA 848 929 7.6e-26 SMART
CA 953 1034 1.5e-25 SMART
CA 1060 1141 6.6e-32 SMART
CA 1165 1247 1.5e-30 SMART
CA 1273 1349 1.8e-8 SMART
CA 1375 1453 2.9e-12 SMART
CA 1477 1559 3e-22 SMART
CA 1583 1664 3.1e-16 SMART
CA 1688 1762 4.2e-22 SMART
CA 1793 1876 2.5e-26 SMART
CA 1900 1975 1.5e-8 SMART
low complexity region 1983 1994 N/A INTRINSIC
CA 1999 2077 1.4e-18 SMART
CA 2101 2179 6.6e-10 SMART
CA 2203 2280 4.9e-19 SMART
CA 2304 2387 4.3e-29 SMART
CA 2411 2489 4.2e-11 SMART
CA 2513 2593 2.8e-22 SMART
CA 2617 2701 4.3e-10 SMART
CA 2719 2807 2.5e-7 SMART
CA 2831 2917 3.3e-27 SMART
CA 2941 3022 9.4e-23 SMART
CA 3046 3124 2.4e-26 SMART
CA 3148 3229 1.3e-32 SMART
CA 3253 3334 1.3e-29 SMART
CA 3358 3439 4.9e-28 SMART
CA 3463 3544 6.4e-12 SMART
EGF 3793 3828 1.3e-1 SMART
LamG 3852 3989 4.3e-25 SMART
EGF 4019 4053 2.7e-6 SMART
EGF 4058 4091 4.5e-6 SMART
EGF_CA 4093 4129 3.9e-11 SMART
transmembrane domain 4151 4170 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217308
AA Change: V915G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozgyous for a knock-out allele exhibit abnormal amacrine cell differentiation and migration that result in the formation of two additional plexiform layers and thickened retinal ganglion layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,515,410 (GRCm38) A71V probably damaging Het
Adamts12 T C 15: 11,311,359 (GRCm38) F1234S probably benign Het
Ahnak A G 19: 9,015,875 (GRCm38) D4841G probably damaging Het
Akap13 T C 7: 75,729,049 (GRCm38) S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 (GRCm38) probably null Het
Arhgef17 G T 7: 100,929,659 (GRCm38) P694Q possibly damaging Het
Arrdc1 T C 2: 24,925,795 (GRCm38) I398V probably benign Het
Ash1l T C 3: 89,052,065 (GRCm38) Y2250H probably damaging Het
Aspg A G 12: 112,121,852 (GRCm38) N385D probably benign Het
Atxn3 G A 12: 101,926,499 (GRCm38) R319C possibly damaging Het
BC005561 T A 5: 104,518,257 (GRCm38) I215N probably damaging Het
Brca2 G A 5: 150,552,258 (GRCm38) A2478T probably damaging Het
C1s1 C T 6: 124,531,131 (GRCm38) C633Y probably damaging Het
C8g C T 2: 25,500,216 (GRCm38) A6T probably benign Het
Cbl A T 9: 44,154,244 (GRCm38) V706E probably benign Het
Cfhr1 C T 1: 139,557,574 (GRCm38) E45K probably benign Het
Chd7 G A 4: 8,840,561 (GRCm38) probably null Het
Chek1 G T 9: 36,725,857 (GRCm38) A2E probably damaging Het
Cntnap1 C A 11: 101,180,360 (GRCm38) F366L probably damaging Het
Corin C T 5: 72,302,790 (GRCm38) probably null Het
Crb2 T C 2: 37,783,388 (GRCm38) Y99H probably damaging Het
Ctdspl2 G A 2: 122,003,929 (GRCm38) R332K probably benign Het
Cym G A 3: 107,213,458 (GRCm38) T277I probably damaging Het
Cyp2d11 C T 15: 82,391,735 (GRCm38) C215Y probably benign Het
Dido1 G A 2: 180,662,328 (GRCm38) P1261L probably damaging Het
Dnah10 T A 5: 124,763,096 (GRCm38) Y1265N probably benign Het
Dtx3l G A 16: 35,932,728 (GRCm38) L503F probably damaging Het
Efhb A G 17: 53,437,178 (GRCm38) F462L probably damaging Het
Enpep T A 3: 129,319,448 (GRCm38) T203S probably damaging Het
Fbln7 A G 2: 128,877,429 (GRCm38) T49A probably benign Het
Fcho1 C T 8: 71,712,560 (GRCm38) A418T probably benign Het
Fgf14 T A 14: 124,676,539 (GRCm38) K60M probably benign Het
Galnt4 A G 10: 99,108,709 (GRCm38) R99G probably benign Het
Gimap4 C A 6: 48,691,282 (GRCm38) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm38) T6I probably damaging Het
Gm10110 A T 14: 89,898,075 (GRCm38) noncoding transcript Het
Gm4884 A G 7: 41,043,128 (GRCm38) K174E probably damaging Het
Gm6583 C T 5: 112,354,764 (GRCm38) G358D probably benign Het
Grip2 A T 6: 91,788,443 (GRCm38) D19E probably damaging Het
Grk4 T C 5: 34,694,750 (GRCm38) S113P probably benign Het
Hectd3 G A 4: 116,996,566 (GRCm38) E220K probably damaging Het
Helz2 G A 2: 181,236,297 (GRCm38) P903S probably damaging Het
Hydin T A 8: 110,532,953 (GRCm38) V2519E possibly damaging Het
Ints11 G A 4: 155,888,110 (GRCm38) probably null Het
Kif1a A G 1: 93,054,929 (GRCm38) W718R possibly damaging Het
Kif1b A T 4: 149,223,252 (GRCm38) Y839N probably damaging Het
Kif20b T A 19: 34,950,599 (GRCm38) V1047D probably benign Het
Klhl23 T C 2: 69,833,888 (GRCm38) I527T probably damaging Het
Klra10 T C 6: 130,279,431 (GRCm38) N87D probably damaging Het
Klra10 T A 6: 130,279,315 (GRCm38) R125S probably damaging Het
Lars G A 18: 42,210,050 (GRCm38) R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 (GRCm38) P166L probably damaging Het
Letmd1 T A 15: 100,472,542 (GRCm38) probably null Het
Map4k2 G T 19: 6,341,917 (GRCm38) W87L probably damaging Het
Mccc1 A G 3: 35,974,286 (GRCm38) V457A probably benign Het
Mdn1 T A 4: 32,730,788 (GRCm38) S2886T probably benign Het
Mroh2b G T 15: 4,925,684 (GRCm38) D720Y probably damaging Het
Mrpl24 T A 3: 87,921,928 (GRCm38) Y21* probably null Het
Mrps35 C T 6: 147,055,984 (GRCm38) T169M probably damaging Het
Mtcl1 T A 17: 66,380,435 (GRCm38) D492V probably damaging Het
Muc2 A G 7: 141,748,974 (GRCm38) Y457C probably damaging Het
Muc4 G A 16: 32,753,595 (GRCm38) G1157D probably benign Het
Myg1 T A 15: 102,337,390 (GRCm38) L275Q probably damaging Het
Naga T A 15: 82,334,788 (GRCm38) M237L probably null Het
Oc90 T A 15: 65,897,720 (GRCm38) Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 (GRCm38) F251I probably damaging Het
Olfr103 A T 17: 37,336,956 (GRCm38) L92H probably benign Het
Olfr1253 C T 2: 89,752,267 (GRCm38) C187Y probably damaging Het
Olfr46 A G 7: 140,610,969 (GRCm38) I268V probably benign Het
Olfr522 A G 7: 140,162,203 (GRCm38) V249A probably damaging Het
Orc4 A T 2: 48,909,494 (GRCm38) C324S possibly damaging Het
Pcdh10 T G 3: 45,379,974 (GRCm38) L241R probably damaging Het
Pdzrn4 T C 15: 92,770,537 (GRCm38) S857P probably benign Het
Plec C T 15: 76,185,908 (GRCm38) E1000K possibly damaging Het
Plvap A T 8: 71,508,481 (GRCm38) V149D probably benign Het
Ppef1 C A X: 160,625,674 (GRCm38) probably null Het
Prkaa1 C A 15: 5,178,798 (GRCm38) P507T probably benign Het
Ptch1 A G 13: 63,524,969 (GRCm38) Y804H probably benign Het
R3hdm2 A G 10: 127,476,690 (GRCm38) I434V probably benign Het
Rfx5 T A 3: 94,956,303 (GRCm38) Y88N probably damaging Het
Rnase2b A T 14: 51,162,839 (GRCm38) K126* probably null Het
Rpl3l A G 17: 24,730,871 (GRCm38) I15V probably benign Het
Saal1 G T 7: 46,702,545 (GRCm38) probably null Het
Sbpl A C 17: 23,953,254 (GRCm38) D230E unknown Het
Scn10a T C 9: 119,666,490 (GRCm38) Y322C probably damaging Het
Sec16a A T 2: 26,431,157 (GRCm38) Y1308N probably damaging Het
Sis A T 3: 72,932,060 (GRCm38) D824E possibly damaging Het
Slc25a36 A G 9: 97,080,355 (GRCm38) F194L probably damaging Het
Slc27a4 T A 2: 29,811,190 (GRCm38) V331E probably damaging Het
Slc7a11 G T 3: 50,381,073 (GRCm38) probably null Het
Slco4c1 A T 1: 96,841,172 (GRCm38) S322T probably damaging Het
Smarcc2 A T 10: 128,474,245 (GRCm38) T376S probably damaging Het
Srebf1 C T 11: 60,200,702 (GRCm38) R999H probably benign Het
St3gal3 A C 4: 118,107,662 (GRCm38) M1R probably null Het
Syp A T X: 7,648,705 (GRCm38) probably benign Het
Tas1r2 A G 4: 139,669,411 (GRCm38) D687G probably damaging Het
Tekt4 A T 17: 25,472,074 (GRCm38) Q118L probably benign Het
Tph2 T C 10: 115,079,695 (GRCm38) N480S probably benign Het
Tsc2 A T 17: 24,608,973 (GRCm38) M839K probably damaging Het
Ttc22 T C 4: 106,622,780 (GRCm38) F77S probably damaging Het
Uaca C T 9: 60,854,321 (GRCm38) A205V possibly damaging Het
Uhmk1 A T 1: 170,208,653 (GRCm38) probably null Het
Usp17lc A G 7: 103,418,941 (GRCm38) H481R possibly damaging Het
Vwa3a A G 7: 120,768,165 (GRCm38) Y181C probably damaging Het
Wfikkn2 G A 11: 94,238,895 (GRCm38) T140I probably damaging Het
Zfp704 G T 3: 9,447,348 (GRCm38) T288N possibly damaging Het
Zfp93 T C 7: 24,276,096 (GRCm38) V502A probably damaging Het
Zzef1 C T 11: 72,924,679 (GRCm38) P2942S probably damaging Het
Other mutations in Fat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Fat3 APN 9 15,996,427 (GRCm38) missense possibly damaging 0.77
IGL00962:Fat3 APN 9 15,915,519 (GRCm38) missense probably benign 0.14
IGL00966:Fat3 APN 9 15,999,094 (GRCm38) missense possibly damaging 0.69
IGL01100:Fat3 APN 9 16,375,228 (GRCm38) missense probably damaging 1.00
IGL01104:Fat3 APN 9 16,375,728 (GRCm38) missense possibly damaging 0.92
IGL01104:Fat3 APN 9 15,998,460 (GRCm38) missense probably damaging 1.00
IGL01121:Fat3 APN 9 15,998,401 (GRCm38) missense probably benign 0.00
IGL01407:Fat3 APN 9 16,378,023 (GRCm38) missense probably benign 0.01
IGL01444:Fat3 APN 9 15,998,848 (GRCm38) missense probably damaging 1.00
IGL01634:Fat3 APN 9 15,998,358 (GRCm38) missense probably damaging 1.00
IGL01649:Fat3 APN 9 16,376,719 (GRCm38) missense possibly damaging 0.95
IGL01839:Fat3 APN 9 15,997,872 (GRCm38) missense probably damaging 1.00
IGL01867:Fat3 APN 9 16,377,901 (GRCm38) missense probably benign 0.03
IGL01894:Fat3 APN 9 16,375,849 (GRCm38) missense probably benign
IGL01913:Fat3 APN 9 15,998,790 (GRCm38) missense probably damaging 0.99
IGL02033:Fat3 APN 9 15,915,352 (GRCm38) missense possibly damaging 0.50
IGL02035:Fat3 APN 9 16,377,970 (GRCm38) missense probably benign 0.06
IGL02146:Fat3 APN 9 15,999,582 (GRCm38) missense probably benign
IGL02147:Fat3 APN 9 15,995,985 (GRCm38) missense probably damaging 1.00
IGL02161:Fat3 APN 9 15,997,050 (GRCm38) missense probably benign 0.10
IGL02161:Fat3 APN 9 15,997,051 (GRCm38) nonsense probably null
IGL02164:Fat3 APN 9 16,031,424 (GRCm38) splice site probably benign
IGL02269:Fat3 APN 9 15,915,577 (GRCm38) missense possibly damaging 0.84
IGL02314:Fat3 APN 9 15,969,838 (GRCm38) missense possibly damaging 0.61
IGL02393:Fat3 APN 9 15,988,412 (GRCm38) nonsense probably null
IGL02410:Fat3 APN 9 15,997,845 (GRCm38) missense probably damaging 1.00
IGL02504:Fat3 APN 9 15,959,798 (GRCm38) missense probably damaging 1.00
IGL02572:Fat3 APN 9 15,960,506 (GRCm38) missense probably benign
IGL02623:Fat3 APN 9 15,997,137 (GRCm38) missense probably damaging 1.00
IGL02654:Fat3 APN 9 15,996,975 (GRCm38) missense possibly damaging 0.84
IGL02749:Fat3 APN 9 16,006,711 (GRCm38) missense possibly damaging 0.93
IGL02810:Fat3 APN 9 16,376,850 (GRCm38) missense probably damaging 1.00
IGL02839:Fat3 APN 9 15,919,170 (GRCm38) missense probably damaging 1.00
IGL02890:Fat3 APN 9 15,915,340 (GRCm38) missense probably benign 0.03
IGL02892:Fat3 APN 9 16,377,562 (GRCm38) missense probably damaging 1.00
IGL03090:Fat3 APN 9 16,377,239 (GRCm38) nonsense probably null
IGL03144:Fat3 APN 9 16,375,245 (GRCm38) missense probably damaging 1.00
IGL03199:Fat3 APN 9 16,377,048 (GRCm38) missense possibly damaging 0.83
IGL03365:Fat3 APN 9 15,996,469 (GRCm38) missense probably damaging 1.00
IGL03392:Fat3 APN 9 16,003,862 (GRCm38) missense probably benign
IGL03408:Fat3 APN 9 15,997,957 (GRCm38) nonsense probably null
gagged UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
hushed UTSW 9 15,959,869 (GRCm38) missense possibly damaging 0.72
Muffled UTSW 9 15,937,991 (GRCm38) critical splice donor site probably null
muted UTSW 9 15,997,477 (GRCm38) missense possibly damaging 0.93
Softened UTSW 9 16,378,185 (GRCm38) missense probably benign
BB001:Fat3 UTSW 9 15,999,297 (GRCm38) missense probably damaging 1.00
BB002:Fat3 UTSW 9 16,031,360 (GRCm38) missense possibly damaging 0.77
BB011:Fat3 UTSW 9 15,999,297 (GRCm38) missense probably damaging 1.00
BB012:Fat3 UTSW 9 16,031,360 (GRCm38) missense possibly damaging 0.77
F6893:Fat3 UTSW 9 16,006,789 (GRCm38) missense probably damaging 0.99
IGL03050:Fat3 UTSW 9 15,996,600 (GRCm38) missense probably benign 0.04
PIT4142001:Fat3 UTSW 9 15,992,118 (GRCm38) critical splice donor site probably null
PIT4283001:Fat3 UTSW 9 16,006,601 (GRCm38) missense possibly damaging 0.77
PIT4378001:Fat3 UTSW 9 16,376,808 (GRCm38) missense probably benign 0.05
PIT4434001:Fat3 UTSW 9 15,996,316 (GRCm38) missense probably benign 0.00
PIT4468001:Fat3 UTSW 9 15,996,351 (GRCm38) missense probably benign 0.06
R0001:Fat3 UTSW 9 16,377,873 (GRCm38) missense probably damaging 0.99
R0005:Fat3 UTSW 9 15,962,866 (GRCm38) missense probably damaging 1.00
R0005:Fat3 UTSW 9 15,962,866 (GRCm38) missense probably damaging 1.00
R0038:Fat3 UTSW 9 15,915,010 (GRCm38) missense probably damaging 1.00
R0046:Fat3 UTSW 9 15,965,979 (GRCm38) missense possibly damaging 0.65
R0089:Fat3 UTSW 9 15,938,205 (GRCm38) missense probably benign
R0135:Fat3 UTSW 9 16,006,777 (GRCm38) missense probably damaging 1.00
R0255:Fat3 UTSW 9 15,969,706 (GRCm38) splice site probably benign
R0349:Fat3 UTSW 9 16,031,180 (GRCm38) missense probably damaging 1.00
R0361:Fat3 UTSW 9 15,998,403 (GRCm38) missense possibly damaging 0.77
R0382:Fat3 UTSW 9 15,959,756 (GRCm38) missense probably damaging 1.00
R0418:Fat3 UTSW 9 16,246,896 (GRCm38) missense probably damaging 1.00
R0419:Fat3 UTSW 9 15,992,256 (GRCm38) missense probably damaging 1.00
R0437:Fat3 UTSW 9 15,996,932 (GRCm38) missense probably damaging 1.00
R0441:Fat3 UTSW 9 15,945,008 (GRCm38) splice site probably benign
R0480:Fat3 UTSW 9 15,997,729 (GRCm38) missense probably benign 0.00
R0510:Fat3 UTSW 9 15,999,685 (GRCm38) nonsense probably null
R0665:Fat3 UTSW 9 15,997,402 (GRCm38) missense probably benign
R0715:Fat3 UTSW 9 16,375,123 (GRCm38) missense probably benign
R0727:Fat3 UTSW 9 15,996,699 (GRCm38) missense probably damaging 1.00
R0882:Fat3 UTSW 9 16,031,368 (GRCm38) missense possibly damaging 0.84
R0946:Fat3 UTSW 9 15,997,804 (GRCm38) missense possibly damaging 0.95
R1068:Fat3 UTSW 9 15,970,034 (GRCm38) missense probably benign
R1081:Fat3 UTSW 9 16,375,284 (GRCm38) missense possibly damaging 0.62
R1082:Fat3 UTSW 9 16,006,615 (GRCm38) missense probably damaging 1.00
R1148:Fat3 UTSW 9 15,996,774 (GRCm38) missense probably damaging 1.00
R1148:Fat3 UTSW 9 15,996,774 (GRCm38) missense probably damaging 1.00
R1233:Fat3 UTSW 9 15,922,745 (GRCm38) missense probably benign
R1306:Fat3 UTSW 9 16,376,679 (GRCm38) missense probably damaging 1.00
R1311:Fat3 UTSW 9 16,021,410 (GRCm38) missense probably damaging 1.00
R1338:Fat3 UTSW 9 15,925,091 (GRCm38) missense probably benign 0.00
R1395:Fat3 UTSW 9 16,246,916 (GRCm38) missense probably benign 0.00
R1466:Fat3 UTSW 9 16,375,482 (GRCm38) missense probably damaging 0.96
R1510:Fat3 UTSW 9 15,960,055 (GRCm38) missense probably damaging 1.00
R1528:Fat3 UTSW 9 15,925,091 (GRCm38) missense probably benign 0.00
R1531:Fat3 UTSW 9 15,997,465 (GRCm38) missense probably damaging 1.00
R1659:Fat3 UTSW 9 15,997,183 (GRCm38) missense possibly damaging 0.91
R1697:Fat3 UTSW 9 15,944,880 (GRCm38) missense probably benign 0.05
R1699:Fat3 UTSW 9 15,938,398 (GRCm38) missense probably damaging 1.00
R1728:Fat3 UTSW 9 15,996,315 (GRCm38) missense possibly damaging 0.65
R1729:Fat3 UTSW 9 15,996,315 (GRCm38) missense possibly damaging 0.65
R1731:Fat3 UTSW 9 15,995,937 (GRCm38) missense probably benign
R1784:Fat3 UTSW 9 15,996,315 (GRCm38) missense possibly damaging 0.65
R1789:Fat3 UTSW 9 16,376,985 (GRCm38) missense probably benign 0.00
R1794:Fat3 UTSW 9 15,997,138 (GRCm38) missense probably benign 0.15
R1794:Fat3 UTSW 9 15,997,136 (GRCm38) nonsense probably null
R1830:Fat3 UTSW 9 15,915,340 (GRCm38) missense probably benign 0.03
R1835:Fat3 UTSW 9 15,998,088 (GRCm38) missense probably damaging 1.00
R1887:Fat3 UTSW 9 15,967,061 (GRCm38) missense probably damaging 1.00
R1898:Fat3 UTSW 9 15,960,130 (GRCm38) missense probably damaging 1.00
R1909:Fat3 UTSW 9 15,998,115 (GRCm38) missense probably benign
R1912:Fat3 UTSW 9 15,969,988 (GRCm38) missense probably damaging 1.00
R1917:Fat3 UTSW 9 15,997,057 (GRCm38) missense possibly damaging 0.55
R1967:Fat3 UTSW 9 15,968,295 (GRCm38) missense probably benign 0.00
R2070:Fat3 UTSW 9 15,999,370 (GRCm38) missense probably benign 0.21
R2100:Fat3 UTSW 9 16,377,430 (GRCm38) missense possibly damaging 0.73
R2104:Fat3 UTSW 9 15,998,517 (GRCm38) missense possibly damaging 0.77
R2113:Fat3 UTSW 9 15,999,786 (GRCm38) missense probably damaging 1.00
R2132:Fat3 UTSW 9 16,246,719 (GRCm38) critical splice donor site probably null
R2136:Fat3 UTSW 9 16,377,051 (GRCm38) missense probably benign 0.01
R2146:Fat3 UTSW 9 15,990,512 (GRCm38) missense probably benign 0.01
R2233:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R2234:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R2273:Fat3 UTSW 9 15,915,262 (GRCm38) missense probably benign
R2285:Fat3 UTSW 9 16,376,173 (GRCm38) missense probably damaging 1.00
R2363:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R2365:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R2367:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R2403:Fat3 UTSW 9 15,969,871 (GRCm38) missense probably damaging 1.00
R2447:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R2496:Fat3 UTSW 9 15,966,103 (GRCm38) missense probably benign 0.01
R2509:Fat3 UTSW 9 15,925,014 (GRCm38) missense possibly damaging 0.82
R2932:Fat3 UTSW 9 16,375,944 (GRCm38) missense probably damaging 1.00
R2986:Fat3 UTSW 9 15,992,128 (GRCm38) missense probably damaging 1.00
R3054:Fat3 UTSW 9 15,960,496 (GRCm38) missense probably benign
R3056:Fat3 UTSW 9 15,960,496 (GRCm38) missense probably benign
R3729:Fat3 UTSW 9 16,247,041 (GRCm38) splice site probably benign
R3745:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R3806:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R3859:Fat3 UTSW 9 15,997,228 (GRCm38) nonsense probably null
R3862:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R3890:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R3892:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R3950:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R3972:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R4004:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R4005:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R4086:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R4111:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R4113:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R4227:Fat3 UTSW 9 16,377,693 (GRCm38) missense probably damaging 1.00
R4352:Fat3 UTSW 9 16,246,778 (GRCm38) missense possibly damaging 0.55
R4394:Fat3 UTSW 9 15,922,792 (GRCm38) missense probably benign 0.11
R4403:Fat3 UTSW 9 15,944,873 (GRCm38) missense probably damaging 1.00
R4433:Fat3 UTSW 9 16,031,152 (GRCm38) missense probably damaging 0.99
R4453:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R4479:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R4480:Fat3 UTSW 9 15,998,271 (GRCm38) missense probably damaging 1.00
R4521:Fat3 UTSW 9 15,922,942 (GRCm38) missense probably null 0.71
R4620:Fat3 UTSW 9 15,996,894 (GRCm38) missense probably damaging 1.00
R4700:Fat3 UTSW 9 16,031,173 (GRCm38) missense probably damaging 1.00
R4721:Fat3 UTSW 9 16,029,966 (GRCm38) missense probably damaging 1.00
R4790:Fat3 UTSW 9 15,998,484 (GRCm38) missense probably damaging 1.00
R4796:Fat3 UTSW 9 15,999,732 (GRCm38) missense probably benign 0.17
R4823:Fat3 UTSW 9 15,996,507 (GRCm38) missense probably benign
R4836:Fat3 UTSW 9 16,377,723 (GRCm38) missense probably damaging 1.00
R4842:Fat3 UTSW 9 15,997,587 (GRCm38) missense probably damaging 1.00
R4849:Fat3 UTSW 9 16,377,948 (GRCm38) missense probably benign 0.03
R4856:Fat3 UTSW 9 16,021,330 (GRCm38) missense probably benign
R4869:Fat3 UTSW 9 16,377,477 (GRCm38) missense probably damaging 0.98
R4886:Fat3 UTSW 9 16,021,330 (GRCm38) missense probably benign
R4899:Fat3 UTSW 9 15,969,799 (GRCm38) missense probably damaging 1.00
R4941:Fat3 UTSW 9 16,375,152 (GRCm38) missense probably damaging 1.00
R4986:Fat3 UTSW 9 15,998,340 (GRCm38) missense probably damaging 1.00
R5058:Fat3 UTSW 9 15,996,858 (GRCm38) missense probably damaging 1.00
R5079:Fat3 UTSW 9 15,999,127 (GRCm38) missense probably benign 0.01
R5080:Fat3 UTSW 9 15,999,338 (GRCm38) missense probably benign 0.35
R5174:Fat3 UTSW 9 15,999,570 (GRCm38) missense probably damaging 1.00
R5183:Fat3 UTSW 9 15,960,313 (GRCm38) missense probably damaging 0.99
R5203:Fat3 UTSW 9 16,378,142 (GRCm38) missense possibly damaging 0.79
R5216:Fat3 UTSW 9 16,377,537 (GRCm38) missense probably damaging 1.00
R5230:Fat3 UTSW 9 15,990,560 (GRCm38) missense possibly damaging 0.51
R5318:Fat3 UTSW 9 16,376,629 (GRCm38) missense probably damaging 1.00
R5377:Fat3 UTSW 9 16,376,443 (GRCm38) missense probably benign 0.05
R5385:Fat3 UTSW 9 15,922,675 (GRCm38) missense possibly damaging 0.82
R5436:Fat3 UTSW 9 15,960,514 (GRCm38) missense probably benign 0.02
R5437:Fat3 UTSW 9 16,085,308 (GRCm38) missense probably damaging 1.00
R5453:Fat3 UTSW 9 15,996,864 (GRCm38) missense probably damaging 1.00
R5460:Fat3 UTSW 9 15,919,167 (GRCm38) missense probably damaging 1.00
R5516:Fat3 UTSW 9 15,998,709 (GRCm38) missense probably damaging 1.00
R5568:Fat3 UTSW 9 16,376,923 (GRCm38) nonsense probably null
R5628:Fat3 UTSW 9 15,966,096 (GRCm38) missense probably damaging 1.00
R5835:Fat3 UTSW 9 16,375,833 (GRCm38) missense probably damaging 1.00
R5845:Fat3 UTSW 9 16,377,210 (GRCm38) missense probably damaging 1.00
R5898:Fat3 UTSW 9 15,938,461 (GRCm38) missense probably benign 0.15
R5941:Fat3 UTSW 9 15,999,501 (GRCm38) missense probably benign 0.07
R5974:Fat3 UTSW 9 16,006,528 (GRCm38) critical splice donor site probably null
R5986:Fat3 UTSW 9 15,998,317 (GRCm38) missense probably benign 0.22
R6015:Fat3 UTSW 9 16,376,050 (GRCm38) missense possibly damaging 0.55
R6031:Fat3 UTSW 9 15,988,492 (GRCm38) missense probably benign 0.02
R6031:Fat3 UTSW 9 15,988,492 (GRCm38) missense probably benign 0.02
R6042:Fat3 UTSW 9 16,377,817 (GRCm38) missense probably benign 0.12
R6051:Fat3 UTSW 9 16,375,455 (GRCm38) missense possibly damaging 0.83
R6052:Fat3 UTSW 9 15,922,679 (GRCm38) missense probably null
R6119:Fat3 UTSW 9 16,376,568 (GRCm38) missense possibly damaging 0.82
R6161:Fat3 UTSW 9 16,377,522 (GRCm38) missense probably damaging 1.00
R6254:Fat3 UTSW 9 15,996,145 (GRCm38) missense probably benign 0.19
R6318:Fat3 UTSW 9 15,916,984 (GRCm38) intron probably benign
R6347:Fat3 UTSW 9 15,998,372 (GRCm38) missense probably damaging 1.00
R6348:Fat3 UTSW 9 15,937,991 (GRCm38) critical splice donor site probably null
R6351:Fat3 UTSW 9 15,938,398 (GRCm38) missense probably damaging 1.00
R6450:Fat3 UTSW 9 15,999,170 (GRCm38) missense possibly damaging 0.51
R6460:Fat3 UTSW 9 15,967,000 (GRCm38) missense probably damaging 1.00
R6524:Fat3 UTSW 9 15,992,256 (GRCm38) missense probably damaging 1.00
R6533:Fat3 UTSW 9 15,998,899 (GRCm38) missense probably benign 0.02
R6565:Fat3 UTSW 9 15,915,327 (GRCm38) missense probably benign
R6576:Fat3 UTSW 9 16,377,210 (GRCm38) missense probably damaging 1.00
R6649:Fat3 UTSW 9 16,376,742 (GRCm38) missense probably damaging 1.00
R6716:Fat3 UTSW 9 15,919,269 (GRCm38) missense probably benign
R6719:Fat3 UTSW 9 15,996,144 (GRCm38) missense probably benign
R6753:Fat3 UTSW 9 15,915,061 (GRCm38) missense possibly damaging 0.82
R6754:Fat3 UTSW 9 15,915,061 (GRCm38) missense possibly damaging 0.82
R6755:Fat3 UTSW 9 15,915,061 (GRCm38) missense possibly damaging 0.82
R6792:Fat3 UTSW 9 16,375,644 (GRCm38) missense probably damaging 1.00
R6802:Fat3 UTSW 9 15,915,061 (GRCm38) missense possibly damaging 0.82
R6803:Fat3 UTSW 9 15,996,787 (GRCm38) missense probably damaging 0.99
R6831:Fat3 UTSW 9 16,376,551 (GRCm38) missense probably damaging 0.98
R6831:Fat3 UTSW 9 15,915,061 (GRCm38) missense possibly damaging 0.82
R6833:Fat3 UTSW 9 15,915,061 (GRCm38) missense possibly damaging 0.82
R6877:Fat3 UTSW 9 15,999,268 (GRCm38) missense probably benign
R6894:Fat3 UTSW 9 15,997,776 (GRCm38) missense probably damaging 1.00
R6915:Fat3 UTSW 9 16,377,748 (GRCm38) missense probably benign 0.37
R6931:Fat3 UTSW 9 15,959,942 (GRCm38) missense possibly damaging 0.89
R6934:Fat3 UTSW 9 16,376,956 (GRCm38) missense probably damaging 0.98
R6940:Fat3 UTSW 9 15,916,800 (GRCm38) splice site probably null
R6959:Fat3 UTSW 9 15,996,885 (GRCm38) missense possibly damaging 0.91
R6969:Fat3 UTSW 9 16,029,916 (GRCm38) missense probably benign 0.29
R6986:Fat3 UTSW 9 16,021,335 (GRCm38) missense probably damaging 1.00
R6993:Fat3 UTSW 9 15,919,221 (GRCm38) missense probably damaging 1.00
R7039:Fat3 UTSW 9 16,376,265 (GRCm38) missense probably damaging 1.00
R7051:Fat3 UTSW 9 16,377,827 (GRCm38) missense probably damaging 1.00
R7089:Fat3 UTSW 9 15,996,918 (GRCm38) missense probably benign 0.01
R7136:Fat3 UTSW 9 16,378,185 (GRCm38) missense probably benign
R7137:Fat3 UTSW 9 15,997,148 (GRCm38) missense probably damaging 1.00
R7154:Fat3 UTSW 9 15,996,864 (GRCm38) missense probably damaging 1.00
R7170:Fat3 UTSW 9 16,006,574 (GRCm38) missense probably damaging 0.99
R7183:Fat3 UTSW 9 15,922,837 (GRCm38) missense possibly damaging 0.81
R7237:Fat3 UTSW 9 16,377,214 (GRCm38) missense probably damaging 1.00
R7288:Fat3 UTSW 9 15,998,592 (GRCm38) missense probably damaging 1.00
R7293:Fat3 UTSW 9 15,915,296 (GRCm38) missense
R7293:Fat3 UTSW 9 15,915,040 (GRCm38) missense
R7381:Fat3 UTSW 9 16,246,987 (GRCm38) missense probably damaging 1.00
R7438:Fat3 UTSW 9 15,988,482 (GRCm38) missense probably benign
R7537:Fat3 UTSW 9 15,938,319 (GRCm38) missense probably damaging 1.00
R7560:Fat3 UTSW 9 15,996,842 (GRCm38) missense probably damaging 1.00
R7585:Fat3 UTSW 9 15,998,262 (GRCm38) missense probably benign 0.03
R7623:Fat3 UTSW 9 15,988,324 (GRCm38) missense probably damaging 1.00
R7624:Fat3 UTSW 9 15,959,869 (GRCm38) missense possibly damaging 0.72
R7684:Fat3 UTSW 9 15,988,268 (GRCm38) critical splice donor site probably null
R7690:Fat3 UTSW 9 15,998,181 (GRCm38) missense probably damaging 1.00
R7804:Fat3 UTSW 9 15,990,592 (GRCm38) missense probably benign 0.01
R7809:Fat3 UTSW 9 16,006,628 (GRCm38) missense probably damaging 1.00
R7924:Fat3 UTSW 9 15,999,297 (GRCm38) missense probably damaging 1.00
R7925:Fat3 UTSW 9 16,031,360 (GRCm38) missense possibly damaging 0.77
R7954:Fat3 UTSW 9 15,998,412 (GRCm38) missense probably damaging 1.00
R8021:Fat3 UTSW 9 15,999,109 (GRCm38) missense probably damaging 0.99
R8118:Fat3 UTSW 9 15,960,104 (GRCm38) missense probably benign
R8141:Fat3 UTSW 9 15,997,066 (GRCm38) missense possibly damaging 0.79
R8163:Fat3 UTSW 9 15,959,759 (GRCm38) missense probably damaging 1.00
R8170:Fat3 UTSW 9 15,947,496 (GRCm38) missense probably damaging 0.97
R8201:Fat3 UTSW 9 15,997,477 (GRCm38) missense possibly damaging 0.93
R8258:Fat3 UTSW 9 15,990,591 (GRCm38) missense possibly damaging 0.79
R8259:Fat3 UTSW 9 15,990,591 (GRCm38) missense possibly damaging 0.79
R8274:Fat3 UTSW 9 16,377,490 (GRCm38) nonsense probably null
R8275:Fat3 UTSW 9 16,246,750 (GRCm38) missense probably damaging 1.00
R8345:Fat3 UTSW 9 15,999,274 (GRCm38) missense probably benign 0.08
R8350:Fat3 UTSW 9 15,915,139 (GRCm38) missense
R8405:Fat3 UTSW 9 15,995,871 (GRCm38) missense probably damaging 1.00
R8421:Fat3 UTSW 9 15,998,184 (GRCm38) missense probably damaging 1.00
R8450:Fat3 UTSW 9 15,915,139 (GRCm38) missense
R8472:Fat3 UTSW 9 16,375,267 (GRCm38) missense possibly damaging 0.90
R8482:Fat3 UTSW 9 16,246,967 (GRCm38) missense probably benign 0.02
R8680:Fat3 UTSW 9 15,997,407 (GRCm38) missense probably damaging 0.99
R8690:Fat3 UTSW 9 15,967,101 (GRCm38) missense probably benign 0.45
R8748:Fat3 UTSW 9 15,922,865 (GRCm38) missense possibly damaging 0.70
R8756:Fat3 UTSW 9 16,376,589 (GRCm38) missense probably damaging 1.00
R8834:Fat3 UTSW 9 16,031,197 (GRCm38) missense probably damaging 1.00
R8848:Fat3 UTSW 9 15,967,102 (GRCm38) missense probably damaging 1.00
R8884:Fat3 UTSW 9 16,029,984 (GRCm38) missense probably damaging 1.00
R8898:Fat3 UTSW 9 15,947,526 (GRCm38) missense probably benign 0.04
R8930:Fat3 UTSW 9 15,999,523 (GRCm38) missense probably benign 0.06
R8932:Fat3 UTSW 9 15,999,523 (GRCm38) missense probably benign 0.06
R8954:Fat3 UTSW 9 16,376,568 (GRCm38) missense probably benign 0.00
R8995:Fat3 UTSW 9 16,375,602 (GRCm38) missense probably damaging 1.00
R9000:Fat3 UTSW 9 16,006,799 (GRCm38) missense probably benign 0.12
R9000:Fat3 UTSW 9 15,960,520 (GRCm38) missense possibly damaging 0.82
R9060:Fat3 UTSW 9 15,999,486 (GRCm38) missense possibly damaging 0.80
R9116:Fat3 UTSW 9 15,998,125 (GRCm38) missense probably benign 0.34
R9136:Fat3 UTSW 9 15,922,442 (GRCm38) missense
R9193:Fat3 UTSW 9 15,998,952 (GRCm38) missense probably benign
R9235:Fat3 UTSW 9 15,922,378 (GRCm38) missense probably null
R9257:Fat3 UTSW 9 15,996,567 (GRCm38) missense probably benign
R9297:Fat3 UTSW 9 15,997,700 (GRCm38) missense probably damaging 1.00
R9307:Fat3 UTSW 9 16,021,423 (GRCm38) missense probably damaging 1.00
R9412:Fat3 UTSW 9 15,997,407 (GRCm38) missense probably damaging 0.99
R9427:Fat3 UTSW 9 16,377,395 (GRCm38) nonsense probably null
R9430:Fat3 UTSW 9 16,376,085 (GRCm38) missense probably damaging 1.00
R9480:Fat3 UTSW 9 16,031,407 (GRCm38) missense probably damaging 1.00
R9497:Fat3 UTSW 9 15,992,208 (GRCm38) missense probably damaging 0.99
R9547:Fat3 UTSW 9 15,999,846 (GRCm38) missense possibly damaging 0.86
R9569:Fat3 UTSW 9 15,919,199 (GRCm38) missense
R9591:Fat3 UTSW 9 16,377,040 (GRCm38) missense probably benign 0.01
R9615:Fat3 UTSW 9 16,378,047 (GRCm38) missense probably benign 0.00
R9649:Fat3 UTSW 9 15,996,758 (GRCm38) missense possibly damaging 0.57
R9671:Fat3 UTSW 9 16,375,575 (GRCm38) missense possibly damaging 0.93
R9750:Fat3 UTSW 9 16,003,861 (GRCm38) missense probably benign 0.00
R9777:Fat3 UTSW 9 15,915,241 (GRCm38) missense probably benign
RF006:Fat3 UTSW 9 15,998,617 (GRCm38) missense probably benign 0.36
X0021:Fat3 UTSW 9 16,029,931 (GRCm38) missense probably null 0.66
X0026:Fat3 UTSW 9 15,996,333 (GRCm38) missense probably benign
X0064:Fat3 UTSW 9 15,919,277 (GRCm38) missense probably benign
Z1176:Fat3 UTSW 9 16,375,617 (GRCm38) missense probably benign
Z1176:Fat3 UTSW 9 16,375,429 (GRCm38) missense probably damaging 1.00
Z1176:Fat3 UTSW 9 15,947,526 (GRCm38) missense probably damaging 0.98
Z1177:Fat3 UTSW 9 15,965,991 (GRCm38) missense possibly damaging 0.68
Z1177:Fat3 UTSW 9 15,947,538 (GRCm38) missense probably damaging 1.00
Z1177:Fat3 UTSW 9 15,923,026 (GRCm38) missense possibly damaging 0.81
Z1177:Fat3 UTSW 9 15,969,835 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGATGGCACCACTTGCTTTGTCTAC -3'
(R):5'- TGATGCTGACTCTGGCTTCAACG -3'

Sequencing Primer
(F):5'- CCCATTATAGTCATTGACCAAAGAG -3'
(R):5'- GAGAGCATACAGACCTTTATGTCCTC -3'
Posted On 2014-03-28