Mutagenetix > Incidental Mutation

Incidental Mutation 'R1466:Cbl'

166064

Institutional Source

Beutler Lab

Gene Symbol

Cbl

Ensembl Gene

ENSMUSG00000034342

Gene Name

Casitas B-lineage lymphoma

Synonyms

Cbl-2, c-Cbl

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.586) question?

Stock #

R1466 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44142976-44234049 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 44154244 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 706 (V706E)

Ref Sequence

ENSEMBL: ENSMUSP00000145827 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037644] [ENSMUST00000205968] [ENSMUST00000206147] [ENSMUST00000206720]

AlphaFold

P22682

Predicted Effect

probably benign
Transcript: ENSMUST00000037644
AA Change: V662E

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000041902
Gene: ENSMUSG00000034342
AA Change: V662E

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	34	46	N/A	INTRINSIC
Pfam:Cbl_N	49	173	9.4e-59	PFAM
Pfam:Cbl_N2	177	260	4.7e-44	PFAM
Pfam:Cbl_N3	262	347	7.2e-48	PFAM
RING	379	417	1.04e-7	SMART
low complexity region	454	463	N/A	INTRINSIC
low complexity region	530	549	N/A	INTRINSIC
UBA	864	901	3.17e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205313

Predicted Effect

probably benign
Transcript: ENSMUST00000205968
AA Change: V689E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206125

Predicted Effect

probably benign
Transcript: ENSMUST00000206147
AA Change: V706E

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

unknown
Transcript: ENSMUST00000206258
AA Change: V5E

Predicted Effect

probably benign
Transcript: ENSMUST00000206720
AA Change: V706E

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)

Coding Region Coverage

1x: 99.4%
3x: 97.9%
10x: 90.8%
20x: 71.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased thymic CD3 and CD4 expression and tyrosine-phosphorylation, lymphoid hyperplasia, and altered splenic hemopoiesis. Females show increased ductal density and branching in mammary fat pads. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd15	C	T	11: 77,515,410	A71V	probably damaging	Het
Adamts12	T	C	15: 11,311,359	F1234S	probably benign	Het
Ahnak	A	G	19: 9,015,875	D4841G	probably damaging	Het
Akap13	T	C	7: 75,729,049	S2095P	possibly damaging	Het
Ampd2	T	C	3: 108,080,337		probably null	Het
Arhgef17	G	T	7: 100,929,659	P694Q	possibly damaging	Het
Arrdc1	T	C	2: 24,925,795	I398V	probably benign	Het
Ash1l	T	C	3: 89,052,065	Y2250H	probably damaging	Het
Aspg	A	G	12: 112,121,852	N385D	probably benign	Het
Atxn3	G	A	12: 101,926,499	R319C	possibly damaging	Het
BC005561	T	A	5: 104,518,257	I215N	probably damaging	Het
Brca2	G	A	5: 150,552,258	A2478T	probably damaging	Het
C1s1	C	T	6: 124,531,131	C633Y	probably damaging	Het
C8g	C	T	2: 25,500,216	A6T	probably benign	Het
Cfhr1	C	T	1: 139,557,574	E45K	probably benign	Het
Chd7	G	A	4: 8,840,561		probably null	Het
Chek1	G	T	9: 36,725,857	A2E	probably damaging	Het
Cntnap1	C	A	11: 101,180,360	F366L	probably damaging	Het
Corin	C	T	5: 72,302,790		probably null	Het
Crb2	T	C	2: 37,783,388	Y99H	probably damaging	Het
Ctdspl2	G	A	2: 122,003,929	R332K	probably benign	Het
Cym	G	A	3: 107,213,458	T277I	probably damaging	Het
Cyp2d11	C	T	15: 82,391,735	C215Y	probably benign	Het
Dido1	G	A	2: 180,662,328	P1261L	probably damaging	Het
Dnah10	T	A	5: 124,763,096	Y1265N	probably benign	Het
Dtx3l	G	A	16: 35,932,728	L503F	probably damaging	Het
Efhb	A	G	17: 53,437,178	F462L	probably damaging	Het
Enpep	T	A	3: 129,319,448	T203S	probably damaging	Het
Fat3	A	C	9: 16,375,482	V915G	probably damaging	Het
Fbln7	A	G	2: 128,877,429	T49A	probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fgf14	T	A	14: 124,676,539	K60M	probably benign	Het
Galnt4	A	G	10: 99,108,709	R99G	probably benign	Het
Gimap4	C	A	6: 48,691,282	Q196K	probably benign	Het
Glcci1	C	T	6: 8,537,964	T6I	probably damaging	Het
Gm10110	A	T	14: 89,898,075		noncoding transcript	Het
Gm4884	A	G	7: 41,043,128	K174E	probably damaging	Het
Gm6583	C	T	5: 112,354,764	G358D	probably benign	Het
Grip2	A	T	6: 91,788,443	D19E	probably damaging	Het
Grk4	T	C	5: 34,694,750	S113P	probably benign	Het
Hectd3	G	A	4: 116,996,566	E220K	probably damaging	Het
Helz2	G	A	2: 181,236,297	P903S	probably damaging	Het
Hydin	T	A	8: 110,532,953	V2519E	possibly damaging	Het
Ints11	G	A	4: 155,888,110		probably null	Het
Kif1a	A	G	1: 93,054,929	W718R	possibly damaging	Het
Kif1b	A	T	4: 149,223,252	Y839N	probably damaging	Het
Kif20b	T	A	19: 34,950,599	V1047D	probably benign	Het
Klhl23	T	C	2: 69,833,888	I527T	probably damaging	Het
Klra10	T	A	6: 130,279,315	R125S	probably damaging	Het
Klra10	T	C	6: 130,279,431	N87D	probably damaging	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lcn4	G	A	2: 26,668,576	P166L	probably damaging	Het
Letmd1	T	A	15: 100,472,542		probably null	Het
Map4k2	G	T	19: 6,341,917	W87L	probably damaging	Het
Mccc1	A	G	3: 35,974,286	V457A	probably benign	Het
Mdn1	T	A	4: 32,730,788	S2886T	probably benign	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Mrpl24	T	A	3: 87,921,928	Y21*	probably null	Het
Mrps35	C	T	6: 147,055,984	T169M	probably damaging	Het
Mtcl1	T	A	17: 66,380,435	D492V	probably damaging	Het
Muc2	A	G	7: 141,748,974	Y457C	probably damaging	Het
Muc4	G	A	16: 32,753,595	G1157D	probably benign	Het
Myg1	T	A	15: 102,337,390	L275Q	probably damaging	Het
Naga	T	A	15: 82,334,788	M237L	probably null	Het
Oc90	T	A	15: 65,897,720	Y96F	probably damaging	Het
Olfr1029	T	A	2: 85,975,995	F251I	probably damaging	Het
Olfr103	A	T	17: 37,336,956	L92H	probably benign	Het
Olfr1253	C	T	2: 89,752,267	C187Y	probably damaging	Het
Olfr46	A	G	7: 140,610,969	I268V	probably benign	Het
Olfr522	A	G	7: 140,162,203	V249A	probably damaging	Het
Orc4	A	T	2: 48,909,494	C324S	possibly damaging	Het
Pcdh10	T	G	3: 45,379,974	L241R	probably damaging	Het
Pdzrn4	T	C	15: 92,770,537	S857P	probably benign	Het
Plec	C	T	15: 76,185,908	E1000K	possibly damaging	Het
Plvap	A	T	8: 71,508,481	V149D	probably benign	Het
Ppef1	C	A	X: 160,625,674		probably null	Het
Prkaa1	C	A	15: 5,178,798	P507T	probably benign	Het
Ptch1	A	G	13: 63,524,969	Y804H	probably benign	Het
R3hdm2	A	G	10: 127,476,690	I434V	probably benign	Het
Rfx5	T	A	3: 94,956,303	Y88N	probably damaging	Het
Rnase2b	A	T	14: 51,162,839	K126*	probably null	Het
Rpl3l	A	G	17: 24,730,871	I15V	probably benign	Het
Saal1	G	T	7: 46,702,545		probably null	Het
Sbpl	A	C	17: 23,953,254	D230E	unknown	Het
Scn10a	T	C	9: 119,666,490	Y322C	probably damaging	Het
Sec16a	A	T	2: 26,431,157	Y1308N	probably damaging	Het
Sis	A	T	3: 72,932,060	D824E	possibly damaging	Het
Slc25a36	A	G	9: 97,080,355	F194L	probably damaging	Het
Slc27a4	T	A	2: 29,811,190	V331E	probably damaging	Het
Slc7a11	G	T	3: 50,381,073		probably null	Het
Slco4c1	A	T	1: 96,841,172	S322T	probably damaging	Het
Smarcc2	A	T	10: 128,474,245	T376S	probably damaging	Het
Srebf1	C	T	11: 60,200,702	R999H	probably benign	Het
St3gal3	A	C	4: 118,107,662	M1R	probably null	Het
Syp	A	T	X: 7,648,705		probably benign	Het
Tas1r2	A	G	4: 139,669,411	D687G	probably damaging	Het
Tekt4	A	T	17: 25,472,074	Q118L	probably benign	Het
Tph2	T	C	10: 115,079,695	N480S	probably benign	Het
Tsc2	A	T	17: 24,608,973	M839K	probably damaging	Het
Ttc22	T	C	4: 106,622,780	F77S	probably damaging	Het
Uaca	C	T	9: 60,854,321	A205V	possibly damaging	Het
Uhmk1	A	T	1: 170,208,653		probably null	Het
Usp17lc	A	G	7: 103,418,941	H481R	possibly damaging	Het
Vwa3a	A	G	7: 120,768,165	Y181C	probably damaging	Het
Wfikkn2	G	A	11: 94,238,895	T140I	probably damaging	Het
Zfp704	G	T	3: 9,447,348	T288N	possibly damaging	Het
Zfp93	T	C	7: 24,276,096	V502A	probably damaging	Het
Zzef1	C	T	11: 72,924,679	P2942S	probably damaging	Het

Other mutations in Cbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Cbl	APN	9	44201198	missense	probably damaging	1.00
IGL01369:Cbl	APN	9	44201061	nonsense	probably null
IGL01434:Cbl	APN	9	44164206	missense	probably damaging	0.99
IGL01866:Cbl	APN	9	44153825	nonsense	probably null
IGL02326:Cbl	APN	9	44151473	missense	possibly damaging	0.94
IGL02956:Cbl	APN	9	44169034	missense	probably damaging	1.00
Bungalow	UTSW	9	44201119	missense	probably damaging	1.00
Casita	UTSW	9	44164165	missense	probably damaging	1.00
tiny_house	UTSW	9	44164152	missense	probably damaging	1.00
R0068:Cbl	UTSW	9	44154194	missense	probably damaging	0.98
R0390:Cbl	UTSW	9	44201005	missense	probably damaging	1.00
R0655:Cbl	UTSW	9	44158752	missense	probably damaging	1.00
R0764:Cbl	UTSW	9	44164152	missense	probably damaging	1.00
R1466:Cbl	UTSW	9	44154244	missense	probably benign	0.10
R1616:Cbl	UTSW	9	44152900	missense	probably damaging	0.99
R1736:Cbl	UTSW	9	44152895	missense	possibly damaging	0.80
R1808:Cbl	UTSW	9	44164229	missense	probably damaging	1.00
R1865:Cbl	UTSW	9	44164165	missense	probably damaging	1.00
R3156:Cbl	UTSW	9	44158850	missense	possibly damaging	0.74
R3431:Cbl	UTSW	9	44151446	makesense	probably null
R4668:Cbl	UTSW	9	44153848	missense	probably benign	0.00
R4700:Cbl	UTSW	9	44173380	missense	probably damaging	1.00
R4866:Cbl	UTSW	9	44152869	missense	probably benign	0.00
R4900:Cbl	UTSW	9	44152869	missense	probably benign	0.00
R4995:Cbl	UTSW	9	44153811	missense	possibly damaging	0.62
R5014:Cbl	UTSW	9	44154399	splice site	probably null
R5324:Cbl	UTSW	9	44154254	missense	probably damaging	0.97
R5353:Cbl	UTSW	9	44173323	missense	probably damaging	1.00
R5382:Cbl	UTSW	9	44159021	missense	probably benign
R5747:Cbl	UTSW	9	44201119	missense	probably damaging	1.00
R5834:Cbl	UTSW	9	44233779	missense	probably damaging	1.00
R6307:Cbl	UTSW	9	44158512	critical splice donor site	probably null
R6755:Cbl	UTSW	9	44173374	missense	probably damaging	0.98
R7393:Cbl	UTSW	9	44154188	critical splice donor site	probably null
R7779:Cbl	UTSW	9	44159096	missense	probably benign
R7789:Cbl	UTSW	9	44163467	missense	probably damaging	1.00
R8094:Cbl	UTSW	9	44163399	missense	probably benign	0.03
R8104:Cbl	UTSW	9	44158539	missense	possibly damaging	0.93
R8146:Cbl	UTSW	9	44164874	missense	probably damaging	1.00
R8340:Cbl	UTSW	9	44159000	missense	possibly damaging	0.77
R8424:Cbl	UTSW	9	44152854	missense	possibly damaging	0.51
R8920:Cbl	UTSW	9	44167273	missense	probably damaging	0.99
R9185:Cbl	UTSW	9	44152840	missense	probably damaging	1.00
X0057:Cbl	UTSW	9	44233767	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTGTGCCACTGTGGAAACAACAC -3'
(R):5'- AGTATTCTAGCGCCTTTTACAAGGAGC -3'

Sequencing Primer
(F):5'- TGTGGAAACAACACAACTGCTTATC -3'
(R):5'- atctgcctgcctctgcc -3'

Posted On

2014-03-28