Incidental Mutation 'R1466:Uaca'
ID 166066
Institutional Source Beutler Lab
Gene Symbol Uaca
Ensembl Gene ENSMUSG00000034485
Gene Name uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms nucling, 2700059D02Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.173) question?
Stock # R1466 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 60701824-60787652 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 60761603 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 205 (A205V)
Ref Sequence ENSEMBL: ENSMUSP00000062047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050183] [ENSMUST00000214354]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000050183
AA Change: A205V

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062047
Gene: ENSMUSG00000034485
AA Change: A205V

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
ANK 35 68 2.66e3 SMART
ANK 69 98 1.96e-3 SMART
ANK 102 131 1.65e-1 SMART
ANK 135 164 1.38e-3 SMART
ANK 168 197 3.65e-3 SMART
ANK 201 230 6.26e-2 SMART
Blast:ANK 234 263 7e-9 BLAST
coiled coil region 301 381 N/A INTRINSIC
coiled coil region 445 626 N/A INTRINSIC
Pfam:TolA_bind_tri 869 943 4e-11 PFAM
coiled coil region 1009 1382 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000214354
AA Change: A205V

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect unknown
Transcript: ENSMUST00000217656
AA Change: A199V
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
Adamts12 T C 15: 11,311,445 (GRCm39) F1234S probably benign Het
Ahnak A G 19: 8,993,239 (GRCm39) D4841G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arhgef17 G T 7: 100,578,866 (GRCm39) P694Q possibly damaging Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Aspg A G 12: 112,088,286 (GRCm39) N385D probably benign Het
Atxn3 G A 12: 101,892,758 (GRCm39) R319C possibly damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
C1s1 C T 6: 124,508,090 (GRCm39) C633Y probably damaging Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Cbl A T 9: 44,065,541 (GRCm39) V706E probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cfhr1 C T 1: 139,485,312 (GRCm39) E45K probably benign Het
Chd7 G A 4: 8,840,561 (GRCm39) probably null Het
Chek1 G T 9: 36,637,153 (GRCm39) A2E probably damaging Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Crb2 T C 2: 37,673,400 (GRCm39) Y99H probably damaging Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Cym G A 3: 107,120,774 (GRCm39) T277I probably damaging Het
Cyp2d11 C T 15: 82,275,936 (GRCm39) C215Y probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dnah10 T A 5: 124,840,160 (GRCm39) Y1265N probably benign Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Efhb A G 17: 53,744,206 (GRCm39) F462L probably damaging Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Fat3 A C 9: 16,286,778 (GRCm39) V915G probably damaging Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Galnt4 A G 10: 98,944,571 (GRCm39) R99G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Gm10110 A T 14: 90,135,511 (GRCm39) noncoding transcript Het
Gm4884 A G 7: 40,692,552 (GRCm39) K174E probably damaging Het
Grip2 A T 6: 91,765,424 (GRCm39) D19E probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T A 8: 111,259,585 (GRCm39) V2519E possibly damaging Het
Ints11 G A 4: 155,972,567 (GRCm39) probably null Het
Kif1a A G 1: 92,982,651 (GRCm39) W718R possibly damaging Het
Kif1b A T 4: 149,307,709 (GRCm39) Y839N probably damaging Het
Kif20b T A 19: 34,927,999 (GRCm39) V1047D probably benign Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Klra10 T A 6: 130,256,278 (GRCm39) R125S probably damaging Het
Klra10 T C 6: 130,256,394 (GRCm39) N87D probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Map4k2 G T 19: 6,391,947 (GRCm39) W87L probably damaging Het
Mccc1 A G 3: 36,028,435 (GRCm39) V457A probably benign Het
Mdn1 T A 4: 32,730,788 (GRCm39) S2886T probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrpl24 T A 3: 87,829,235 (GRCm39) Y21* probably null Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Mtcl1 T A 17: 66,687,430 (GRCm39) D492V probably damaging Het
Muc2 A G 7: 141,302,711 (GRCm39) Y457C probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Myg1 T A 15: 102,245,825 (GRCm39) L275Q probably damaging Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or12d13 A T 17: 37,647,847 (GRCm39) L92H probably benign Het
Or13a18 A G 7: 140,190,882 (GRCm39) I268V probably benign Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pcdh10 T G 3: 45,334,409 (GRCm39) L241R probably damaging Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Ppef1 C A X: 159,408,670 (GRCm39) probably null Het
Prkaa1 C A 15: 5,208,279 (GRCm39) P507T probably benign Het
Ptch1 A G 13: 63,672,783 (GRCm39) Y804H probably benign Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rfx5 T A 3: 94,863,614 (GRCm39) Y88N probably damaging Het
Rnase2b A T 14: 51,400,296 (GRCm39) K126* probably null Het
Rpl3l A G 17: 24,949,845 (GRCm39) I15V probably benign Het
Saal1 G T 7: 46,351,969 (GRCm39) probably null Het
Sbpl A C 17: 24,172,228 (GRCm39) D230E unknown Het
Scn10a T C 9: 119,495,556 (GRCm39) Y322C probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc25a36 A G 9: 96,962,408 (GRCm39) F194L probably damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Slc7a11 G T 3: 50,335,522 (GRCm39) probably null Het
Slco4c1 A T 1: 96,768,897 (GRCm39) S322T probably damaging Het
Smarcc2 A T 10: 128,310,114 (GRCm39) T376S probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Syp A T X: 7,514,944 (GRCm39) probably benign Het
Tas1r2 A G 4: 139,396,722 (GRCm39) D687G probably damaging Het
Tekt4 A T 17: 25,691,048 (GRCm39) Q118L probably benign Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tph2 T C 10: 114,915,600 (GRCm39) N480S probably benign Het
Tsc2 A T 17: 24,827,947 (GRCm39) M839K probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Zfp704 G T 3: 9,512,408 (GRCm39) T288N possibly damaging Het
Zfp93 T C 7: 23,975,521 (GRCm39) V502A probably damaging Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Uaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Uaca APN 9 60,779,507 (GRCm39) missense probably benign
IGL01751:Uaca APN 9 60,777,139 (GRCm39) missense probably damaging 1.00
IGL02868:Uaca APN 9 60,770,919 (GRCm39) missense probably damaging 1.00
IGL02977:Uaca APN 9 60,773,662 (GRCm39) missense probably benign 0.00
IGL03037:Uaca APN 9 60,748,147 (GRCm39) missense probably damaging 1.00
IGL03060:Uaca APN 9 60,777,148 (GRCm39) missense probably damaging 1.00
IGL03083:Uaca APN 9 60,770,945 (GRCm39) missense probably benign 0.28
IGL03266:Uaca APN 9 60,770,689 (GRCm39) missense probably damaging 1.00
IGL03346:Uaca APN 9 60,761,600 (GRCm39) missense probably damaging 1.00
Ixtapa UTSW 9 60,777,695 (GRCm39) missense probably damaging 0.99
oaxaca UTSW 9 60,778,733 (GRCm39) missense probably benign
R0408:Uaca UTSW 9 60,779,141 (GRCm39) missense possibly damaging 0.71
R0567:Uaca UTSW 9 60,778,663 (GRCm39) missense probably benign 0.01
R0598:Uaca UTSW 9 60,778,203 (GRCm39) nonsense probably null
R0603:Uaca UTSW 9 60,778,379 (GRCm39) missense possibly damaging 0.60
R0655:Uaca UTSW 9 60,779,311 (GRCm39) missense probably benign 0.03
R0707:Uaca UTSW 9 60,755,900 (GRCm39) splice site probably benign
R0791:Uaca UTSW 9 60,779,341 (GRCm39) missense possibly damaging 0.50
R1466:Uaca UTSW 9 60,761,603 (GRCm39) missense possibly damaging 0.88
R1520:Uaca UTSW 9 60,778,663 (GRCm39) missense probably benign 0.30
R1673:Uaca UTSW 9 60,779,438 (GRCm39) missense probably damaging 1.00
R1894:Uaca UTSW 9 60,777,718 (GRCm39) missense possibly damaging 0.87
R1997:Uaca UTSW 9 60,777,623 (GRCm39) missense probably damaging 1.00
R2042:Uaca UTSW 9 60,777,173 (GRCm39) missense probably damaging 1.00
R2095:Uaca UTSW 9 60,748,125 (GRCm39) missense probably benign 0.00
R2148:Uaca UTSW 9 60,776,961 (GRCm39) missense probably damaging 1.00
R2384:Uaca UTSW 9 60,777,199 (GRCm39) missense probably damaging 1.00
R3110:Uaca UTSW 9 60,778,781 (GRCm39) missense probably damaging 1.00
R3112:Uaca UTSW 9 60,778,781 (GRCm39) missense probably damaging 1.00
R4001:Uaca UTSW 9 60,778,366 (GRCm39) missense probably benign 0.04
R4155:Uaca UTSW 9 60,779,035 (GRCm39) missense probably benign 0.02
R4156:Uaca UTSW 9 60,779,035 (GRCm39) missense probably benign 0.02
R4157:Uaca UTSW 9 60,779,035 (GRCm39) missense probably benign 0.02
R4410:Uaca UTSW 9 60,777,173 (GRCm39) missense probably damaging 1.00
R4674:Uaca UTSW 9 60,761,711 (GRCm39) missense possibly damaging 0.94
R4871:Uaca UTSW 9 60,753,283 (GRCm39) missense probably damaging 1.00
R5130:Uaca UTSW 9 60,787,510 (GRCm39) missense probably damaging 0.96
R5328:Uaca UTSW 9 60,777,814 (GRCm39) missense probably benign 0.44
R5358:Uaca UTSW 9 60,778,430 (GRCm39) missense probably benign
R5415:Uaca UTSW 9 60,777,421 (GRCm39) missense possibly damaging 0.65
R5437:Uaca UTSW 9 60,778,733 (GRCm39) missense probably benign
R5647:Uaca UTSW 9 60,779,380 (GRCm39) missense probably benign 0.28
R5710:Uaca UTSW 9 60,779,093 (GRCm39) missense probably damaging 1.00
R5920:Uaca UTSW 9 60,776,885 (GRCm39) missense probably benign 0.19
R5931:Uaca UTSW 9 60,779,294 (GRCm39) missense probably damaging 0.97
R5933:Uaca UTSW 9 60,748,238 (GRCm39) missense probably damaging 1.00
R5959:Uaca UTSW 9 60,778,052 (GRCm39) missense probably damaging 1.00
R6193:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6195:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6242:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6243:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6244:Uaca UTSW 9 60,777,326 (GRCm39) missense probably damaging 0.99
R6274:Uaca UTSW 9 60,757,573 (GRCm39) splice site probably null
R6670:Uaca UTSW 9 60,779,306 (GRCm39) missense probably benign 0.09
R6883:Uaca UTSW 9 60,777,173 (GRCm39) missense probably damaging 1.00
R7011:Uaca UTSW 9 60,777,650 (GRCm39) missense probably damaging 1.00
R7111:Uaca UTSW 9 60,779,120 (GRCm39) missense probably benign 0.06
R7146:Uaca UTSW 9 60,777,695 (GRCm39) missense probably damaging 0.99
R7424:Uaca UTSW 9 60,777,392 (GRCm39) missense probably damaging 1.00
R7485:Uaca UTSW 9 60,753,282 (GRCm39) missense probably damaging 1.00
R7510:Uaca UTSW 9 60,757,487 (GRCm39) splice site probably null
R7688:Uaca UTSW 9 60,781,409 (GRCm39) missense probably benign 0.11
R7724:Uaca UTSW 9 60,777,187 (GRCm39) missense probably benign 0.24
R7743:Uaca UTSW 9 60,783,677 (GRCm39) missense probably damaging 0.99
R8556:Uaca UTSW 9 60,777,923 (GRCm39) missense probably damaging 0.97
R8699:Uaca UTSW 9 60,778,347 (GRCm39) missense probably damaging 1.00
R8814:Uaca UTSW 9 60,773,680 (GRCm39) missense possibly damaging 0.82
R8828:Uaca UTSW 9 60,778,852 (GRCm39) missense probably benign 0.00
R9475:Uaca UTSW 9 60,779,498 (GRCm39) missense possibly damaging 0.88
R9477:Uaca UTSW 9 60,778,108 (GRCm39) missense probably benign 0.33
R9509:Uaca UTSW 9 60,779,498 (GRCm39) missense possibly damaging 0.88
X0067:Uaca UTSW 9 60,766,431 (GRCm39) missense possibly damaging 0.69
Z1177:Uaca UTSW 9 60,781,405 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAATCTGACTTCCTCCACTGG -3'
(R):5'- AAACCCACCGCCACCTTTGTTG -3'

Sequencing Primer
(F):5'- ccagggcagtgagaacag -3'
(R):5'- GCCACCTTTGTTGGTGTTTTC -3'
Posted On 2014-03-28