Incidental Mutation 'R1466:Zzef1'
ID 166077
Institutional Source Beutler Lab
Gene Symbol Zzef1
Ensembl Gene ENSMUSG00000055670
Gene Name zinc finger, ZZ-type with EF hand domain 1
Synonyms 8430405D05Rik, C130099L13Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1466 (G1)
Quality Score 198
Status Not validated
Chromosome 11
Chromosomal Location 72687052-72817946 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72815505 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 2942 (P2942S)
Ref Sequence ENSEMBL: ENSMUSP00000147028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000069395
AA Change: P2880S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: P2880S

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1122 1192 1.25e-7 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2657 2726 1.25e-7 PROSPERO
low complexity region 2840 2853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152481
Predicted Effect probably damaging
Transcript: ENSMUST00000172220
AA Change: P2913S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: P2913S

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1006 1192 1.57e-16 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2583 2759 1.57e-16 PROSPERO
low complexity region 2873 2886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207107
AA Change: P2942S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1243 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
Adamts12 T C 15: 11,311,445 (GRCm39) F1234S probably benign Het
Ahnak A G 19: 8,993,239 (GRCm39) D4841G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arhgef17 G T 7: 100,578,866 (GRCm39) P694Q possibly damaging Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Aspg A G 12: 112,088,286 (GRCm39) N385D probably benign Het
Atxn3 G A 12: 101,892,758 (GRCm39) R319C possibly damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
C1s1 C T 6: 124,508,090 (GRCm39) C633Y probably damaging Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Cbl A T 9: 44,065,541 (GRCm39) V706E probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cfhr1 C T 1: 139,485,312 (GRCm39) E45K probably benign Het
Chd7 G A 4: 8,840,561 (GRCm39) probably null Het
Chek1 G T 9: 36,637,153 (GRCm39) A2E probably damaging Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Crb2 T C 2: 37,673,400 (GRCm39) Y99H probably damaging Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Cym G A 3: 107,120,774 (GRCm39) T277I probably damaging Het
Cyp2d11 C T 15: 82,275,936 (GRCm39) C215Y probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dnah10 T A 5: 124,840,160 (GRCm39) Y1265N probably benign Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Efhb A G 17: 53,744,206 (GRCm39) F462L probably damaging Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Fat3 A C 9: 16,286,778 (GRCm39) V915G probably damaging Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Galnt4 A G 10: 98,944,571 (GRCm39) R99G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Gm10110 A T 14: 90,135,511 (GRCm39) noncoding transcript Het
Gm4884 A G 7: 40,692,552 (GRCm39) K174E probably damaging Het
Grip2 A T 6: 91,765,424 (GRCm39) D19E probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T A 8: 111,259,585 (GRCm39) V2519E possibly damaging Het
Ints11 G A 4: 155,972,567 (GRCm39) probably null Het
Kif1a A G 1: 92,982,651 (GRCm39) W718R possibly damaging Het
Kif1b A T 4: 149,307,709 (GRCm39) Y839N probably damaging Het
Kif20b T A 19: 34,927,999 (GRCm39) V1047D probably benign Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Klra10 T A 6: 130,256,278 (GRCm39) R125S probably damaging Het
Klra10 T C 6: 130,256,394 (GRCm39) N87D probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Map4k2 G T 19: 6,391,947 (GRCm39) W87L probably damaging Het
Mccc1 A G 3: 36,028,435 (GRCm39) V457A probably benign Het
Mdn1 T A 4: 32,730,788 (GRCm39) S2886T probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrpl24 T A 3: 87,829,235 (GRCm39) Y21* probably null Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Mtcl1 T A 17: 66,687,430 (GRCm39) D492V probably damaging Het
Muc2 A G 7: 141,302,711 (GRCm39) Y457C probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Myg1 T A 15: 102,245,825 (GRCm39) L275Q probably damaging Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or12d13 A T 17: 37,647,847 (GRCm39) L92H probably benign Het
Or13a18 A G 7: 140,190,882 (GRCm39) I268V probably benign Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pcdh10 T G 3: 45,334,409 (GRCm39) L241R probably damaging Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Ppef1 C A X: 159,408,670 (GRCm39) probably null Het
Prkaa1 C A 15: 5,208,279 (GRCm39) P507T probably benign Het
Ptch1 A G 13: 63,672,783 (GRCm39) Y804H probably benign Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rfx5 T A 3: 94,863,614 (GRCm39) Y88N probably damaging Het
Rnase2b A T 14: 51,400,296 (GRCm39) K126* probably null Het
Rpl3l A G 17: 24,949,845 (GRCm39) I15V probably benign Het
Saal1 G T 7: 46,351,969 (GRCm39) probably null Het
Sbpl A C 17: 24,172,228 (GRCm39) D230E unknown Het
Scn10a T C 9: 119,495,556 (GRCm39) Y322C probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc25a36 A G 9: 96,962,408 (GRCm39) F194L probably damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Slc7a11 G T 3: 50,335,522 (GRCm39) probably null Het
Slco4c1 A T 1: 96,768,897 (GRCm39) S322T probably damaging Het
Smarcc2 A T 10: 128,310,114 (GRCm39) T376S probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Syp A T X: 7,514,944 (GRCm39) probably benign Het
Tas1r2 A G 4: 139,396,722 (GRCm39) D687G probably damaging Het
Tekt4 A T 17: 25,691,048 (GRCm39) Q118L probably benign Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tph2 T C 10: 114,915,600 (GRCm39) N480S probably benign Het
Tsc2 A T 17: 24,827,947 (GRCm39) M839K probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Uaca C T 9: 60,761,603 (GRCm39) A205V possibly damaging Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Zfp704 G T 3: 9,512,408 (GRCm39) T288N possibly damaging Het
Zfp93 T C 7: 23,975,521 (GRCm39) V502A probably damaging Het
Other mutations in Zzef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Zzef1 APN 11 72,765,952 (GRCm39) missense probably benign 0.02
IGL00898:Zzef1 APN 11 72,765,999 (GRCm39) missense probably benign 0.00
IGL00970:Zzef1 APN 11 72,806,071 (GRCm39) missense probably benign 0.06
IGL01062:Zzef1 APN 11 72,765,795 (GRCm39) missense probably benign
IGL01832:Zzef1 APN 11 72,765,892 (GRCm39) missense probably damaging 0.99
IGL02005:Zzef1 APN 11 72,779,125 (GRCm39) missense probably benign 0.00
IGL02026:Zzef1 APN 11 72,772,164 (GRCm39) missense probably benign 0.39
IGL02110:Zzef1 APN 11 72,803,938 (GRCm39) missense probably damaging 1.00
IGL02305:Zzef1 APN 11 72,757,423 (GRCm39) splice site probably benign
IGL02308:Zzef1 APN 11 72,777,573 (GRCm39) missense probably benign 0.04
IGL02315:Zzef1 APN 11 72,766,083 (GRCm39) nonsense probably null
IGL02332:Zzef1 APN 11 72,807,335 (GRCm39) missense probably benign 0.01
IGL02389:Zzef1 APN 11 72,782,043 (GRCm39) missense probably benign
IGL02389:Zzef1 APN 11 72,790,364 (GRCm39) missense possibly damaging 0.89
IGL02451:Zzef1 APN 11 72,792,214 (GRCm39) missense probably damaging 0.99
IGL02541:Zzef1 APN 11 72,763,475 (GRCm39) missense probably damaging 1.00
IGL02950:Zzef1 APN 11 72,808,525 (GRCm39) splice site probably benign
IGL02953:Zzef1 APN 11 72,746,224 (GRCm39) missense probably benign
IGL03053:Zzef1 APN 11 72,722,365 (GRCm39) splice site probably benign
IGL03085:Zzef1 APN 11 72,746,350 (GRCm39) splice site probably benign
IGL03152:Zzef1 APN 11 72,814,008 (GRCm39) critical splice donor site probably null
IGL03329:Zzef1 APN 11 72,808,099 (GRCm39) splice site probably benign
IGL03376:Zzef1 APN 11 72,767,377 (GRCm39) splice site probably benign
IGL03394:Zzef1 APN 11 72,777,601 (GRCm39) splice site probably null
Dreidel UTSW 11 72,799,295 (GRCm39) nonsense probably null
Hanukkah UTSW 11 72,784,158 (GRCm39) missense probably benign 0.00
Mezuzah UTSW 11 72,739,559 (GRCm39) nonsense probably null
BB005:Zzef1 UTSW 11 72,712,722 (GRCm39) missense probably damaging 0.99
BB015:Zzef1 UTSW 11 72,712,722 (GRCm39) missense probably damaging 0.99
PIT4508001:Zzef1 UTSW 11 72,786,002 (GRCm39) missense probably benign
PIT4581001:Zzef1 UTSW 11 72,790,498 (GRCm39) missense probably benign 0.00
PIT4810001:Zzef1 UTSW 11 72,741,571 (GRCm39) missense probably damaging 1.00
R0094:Zzef1 UTSW 11 72,708,791 (GRCm39) missense probably benign 0.01
R0119:Zzef1 UTSW 11 72,712,677 (GRCm39) missense probably benign
R0136:Zzef1 UTSW 11 72,712,677 (GRCm39) missense probably benign
R0140:Zzef1 UTSW 11 72,790,377 (GRCm39) missense possibly damaging 0.70
R0212:Zzef1 UTSW 11 72,764,736 (GRCm39) missense possibly damaging 0.66
R0217:Zzef1 UTSW 11 72,779,894 (GRCm39) missense probably damaging 1.00
R0220:Zzef1 UTSW 11 72,756,792 (GRCm39) missense probably damaging 1.00
R0304:Zzef1 UTSW 11 72,771,450 (GRCm39) missense probably benign 0.10
R0400:Zzef1 UTSW 11 72,786,068 (GRCm39) missense probably damaging 1.00
R0422:Zzef1 UTSW 11 72,756,917 (GRCm39) missense possibly damaging 0.93
R0471:Zzef1 UTSW 11 72,813,937 (GRCm39) missense probably damaging 1.00
R0557:Zzef1 UTSW 11 72,808,556 (GRCm39) missense probably damaging 1.00
R0581:Zzef1 UTSW 11 72,742,726 (GRCm39) missense probably benign 0.00
R0599:Zzef1 UTSW 11 72,804,004 (GRCm39) missense probably damaging 1.00
R0603:Zzef1 UTSW 11 72,708,895 (GRCm39) missense probably benign 0.00
R0657:Zzef1 UTSW 11 72,712,677 (GRCm39) missense probably benign
R0987:Zzef1 UTSW 11 72,792,159 (GRCm39) small deletion probably benign
R1246:Zzef1 UTSW 11 72,765,735 (GRCm39) missense probably benign 0.00
R1327:Zzef1 UTSW 11 72,784,240 (GRCm39) critical splice donor site probably null
R1438:Zzef1 UTSW 11 72,803,771 (GRCm39) missense probably damaging 0.96
R1466:Zzef1 UTSW 11 72,815,505 (GRCm39) missense probably damaging 1.00
R1485:Zzef1 UTSW 11 72,791,635 (GRCm39) splice site probably null
R1556:Zzef1 UTSW 11 72,806,059 (GRCm39) missense probably damaging 1.00
R1563:Zzef1 UTSW 11 72,739,559 (GRCm39) nonsense probably null
R1584:Zzef1 UTSW 11 72,815,505 (GRCm39) missense probably damaging 1.00
R1643:Zzef1 UTSW 11 72,717,028 (GRCm39) missense probably damaging 1.00
R1646:Zzef1 UTSW 11 72,754,862 (GRCm39) critical splice donor site probably null
R1764:Zzef1 UTSW 11 72,784,158 (GRCm39) missense probably benign 0.00
R1777:Zzef1 UTSW 11 72,801,098 (GRCm39) missense probably damaging 1.00
R1793:Zzef1 UTSW 11 72,777,535 (GRCm39) missense probably damaging 1.00
R1900:Zzef1 UTSW 11 72,739,540 (GRCm39) missense probably damaging 0.99
R2096:Zzef1 UTSW 11 72,763,465 (GRCm39) missense probably benign 0.02
R2134:Zzef1 UTSW 11 72,771,450 (GRCm39) missense probably benign 0.02
R2157:Zzef1 UTSW 11 72,739,460 (GRCm39) splice site probably benign
R2183:Zzef1 UTSW 11 72,777,544 (GRCm39) nonsense probably null
R2192:Zzef1 UTSW 11 72,800,982 (GRCm39) splice site probably null
R2230:Zzef1 UTSW 11 72,775,242 (GRCm39) missense probably damaging 0.99
R2259:Zzef1 UTSW 11 72,791,459 (GRCm39) nonsense probably null
R2384:Zzef1 UTSW 11 72,749,220 (GRCm39) missense probably damaging 0.99
R2426:Zzef1 UTSW 11 72,806,091 (GRCm39) missense probably benign 0.01
R2915:Zzef1 UTSW 11 72,801,152 (GRCm39) splice site probably null
R3700:Zzef1 UTSW 11 72,777,598 (GRCm39) missense probably null 1.00
R3875:Zzef1 UTSW 11 72,779,866 (GRCm39) missense probably benign 0.22
R3902:Zzef1 UTSW 11 72,799,326 (GRCm39) missense probably damaging 1.00
R3927:Zzef1 UTSW 11 72,749,208 (GRCm39) missense probably damaging 1.00
R4086:Zzef1 UTSW 11 72,765,879 (GRCm39) missense probably benign 0.02
R4301:Zzef1 UTSW 11 72,779,861 (GRCm39) missense probably damaging 0.96
R4359:Zzef1 UTSW 11 72,714,334 (GRCm39) missense probably damaging 0.98
R4382:Zzef1 UTSW 11 72,765,938 (GRCm39) missense probably benign 0.00
R4453:Zzef1 UTSW 11 72,763,465 (GRCm39) missense probably benign 0.02
R4466:Zzef1 UTSW 11 72,815,485 (GRCm39) missense probably damaging 1.00
R4471:Zzef1 UTSW 11 72,804,157 (GRCm39) missense probably damaging 1.00
R4510:Zzef1 UTSW 11 72,778,996 (GRCm39) missense probably benign 0.32
R4511:Zzef1 UTSW 11 72,778,996 (GRCm39) missense probably benign 0.32
R4714:Zzef1 UTSW 11 72,728,038 (GRCm39) missense probably damaging 1.00
R4799:Zzef1 UTSW 11 72,750,449 (GRCm39) missense probably benign 0.12
R4906:Zzef1 UTSW 11 72,792,214 (GRCm39) missense probably damaging 1.00
R5075:Zzef1 UTSW 11 72,749,170 (GRCm39) missense probably damaging 1.00
R5357:Zzef1 UTSW 11 72,734,159 (GRCm39) nonsense probably null
R5579:Zzef1 UTSW 11 72,791,463 (GRCm39) missense probably damaging 0.98
R5598:Zzef1 UTSW 11 72,807,347 (GRCm39) missense probably damaging 1.00
R5725:Zzef1 UTSW 11 72,746,308 (GRCm39) missense possibly damaging 0.86
R5765:Zzef1 UTSW 11 72,712,763 (GRCm39) nonsense probably null
R5928:Zzef1 UTSW 11 72,803,678 (GRCm39) missense probably damaging 1.00
R6003:Zzef1 UTSW 11 72,714,891 (GRCm39) splice site probably null
R6047:Zzef1 UTSW 11 72,756,921 (GRCm39) missense probably damaging 0.99
R6224:Zzef1 UTSW 11 72,746,209 (GRCm39) missense probably damaging 0.99
R6225:Zzef1 UTSW 11 72,760,631 (GRCm39) missense possibly damaging 0.62
R6287:Zzef1 UTSW 11 72,813,938 (GRCm39) missense probably damaging 1.00
R6361:Zzef1 UTSW 11 72,775,175 (GRCm39) missense possibly damaging 0.93
R6451:Zzef1 UTSW 11 72,813,982 (GRCm39) missense possibly damaging 0.88
R6467:Zzef1 UTSW 11 72,802,090 (GRCm39) critical splice donor site probably null
R6484:Zzef1 UTSW 11 72,786,097 (GRCm39) missense probably damaging 1.00
R6493:Zzef1 UTSW 11 72,804,129 (GRCm39) missense probably benign 0.06
R6520:Zzef1 UTSW 11 72,716,891 (GRCm39) missense probably damaging 1.00
R6527:Zzef1 UTSW 11 72,765,816 (GRCm39) missense probably benign 0.00
R6540:Zzef1 UTSW 11 72,804,055 (GRCm39) missense probably damaging 1.00
R6608:Zzef1 UTSW 11 72,803,652 (GRCm39) missense probably damaging 1.00
R6795:Zzef1 UTSW 11 72,741,485 (GRCm39) missense probably benign 0.00
R6927:Zzef1 UTSW 11 72,803,983 (GRCm39) missense probably damaging 1.00
R6987:Zzef1 UTSW 11 72,746,340 (GRCm39) missense possibly damaging 0.89
R7048:Zzef1 UTSW 11 72,757,525 (GRCm39) nonsense probably null
R7076:Zzef1 UTSW 11 72,790,385 (GRCm39) missense probably benign 0.00
R7099:Zzef1 UTSW 11 72,763,475 (GRCm39) missense possibly damaging 0.92
R7132:Zzef1 UTSW 11 72,808,697 (GRCm39) critical splice donor site probably null
R7175:Zzef1 UTSW 11 72,742,727 (GRCm39) missense possibly damaging 0.49
R7284:Zzef1 UTSW 11 72,777,516 (GRCm39) missense probably damaging 0.99
R7300:Zzef1 UTSW 11 72,765,830 (GRCm39) missense probably benign 0.02
R7486:Zzef1 UTSW 11 72,755,612 (GRCm39) missense possibly damaging 0.85
R7503:Zzef1 UTSW 11 72,716,893 (GRCm39) missense probably damaging 1.00
R7679:Zzef1 UTSW 11 72,784,104 (GRCm39) missense probably benign
R7874:Zzef1 UTSW 11 72,750,479 (GRCm39) missense probably benign 0.01
R7898:Zzef1 UTSW 11 72,687,373 (GRCm39) missense probably damaging 1.00
R7928:Zzef1 UTSW 11 72,712,722 (GRCm39) missense probably damaging 0.99
R8021:Zzef1 UTSW 11 72,714,242 (GRCm39) missense probably damaging 0.99
R8145:Zzef1 UTSW 11 72,799,295 (GRCm39) nonsense probably null
R8255:Zzef1 UTSW 11 72,765,955 (GRCm39) missense probably benign 0.00
R8303:Zzef1 UTSW 11 72,808,015 (GRCm39) missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72,777,572 (GRCm39) missense probably damaging 0.97
R8492:Zzef1 UTSW 11 72,763,430 (GRCm39) missense probably damaging 1.00
R8498:Zzef1 UTSW 11 72,744,148 (GRCm39) missense probably damaging 1.00
R8547:Zzef1 UTSW 11 72,735,267 (GRCm39) missense probably damaging 1.00
R8874:Zzef1 UTSW 11 72,754,815 (GRCm39) missense probably benign 0.00
R8885:Zzef1 UTSW 11 72,687,402 (GRCm39) missense probably benign 0.00
R8972:Zzef1 UTSW 11 72,791,499 (GRCm39) missense probably damaging 1.00
R8979:Zzef1 UTSW 11 72,766,003 (GRCm39) missense probably benign 0.00
R9053:Zzef1 UTSW 11 72,813,302 (GRCm39) missense probably benign
R9108:Zzef1 UTSW 11 72,790,604 (GRCm39) missense probably benign 0.11
R9121:Zzef1 UTSW 11 72,756,946 (GRCm39) nonsense probably null
R9253:Zzef1 UTSW 11 72,739,463 (GRCm39) splice site probably benign
R9370:Zzef1 UTSW 11 72,744,148 (GRCm39) missense probably damaging 1.00
R9408:Zzef1 UTSW 11 72,755,653 (GRCm39) missense possibly damaging 0.86
R9467:Zzef1 UTSW 11 72,807,251 (GRCm39) missense probably damaging 1.00
R9468:Zzef1 UTSW 11 72,814,009 (GRCm39) critical splice donor site probably null
R9563:Zzef1 UTSW 11 72,765,732 (GRCm39) missense probably damaging 1.00
R9647:Zzef1 UTSW 11 72,760,651 (GRCm39) missense probably benign 0.01
R9667:Zzef1 UTSW 11 72,758,786 (GRCm39) missense probably benign
R9742:Zzef1 UTSW 11 72,749,179 (GRCm39) missense probably benign
X0028:Zzef1 UTSW 11 72,797,805 (GRCm39) missense probably benign 0.29
Z1176:Zzef1 UTSW 11 72,687,354 (GRCm39) missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72,791,457 (GRCm39) critical splice acceptor site probably null
Z1177:Zzef1 UTSW 11 72,717,004 (GRCm39) missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72,687,138 (GRCm39) missense possibly damaging 0.91
Z1177:Zzef1 UTSW 11 72,806,146 (GRCm39) missense probably damaging 1.00
Z1186:Zzef1 UTSW 11 72,780,008 (GRCm39) missense probably benign
Z1187:Zzef1 UTSW 11 72,780,008 (GRCm39) missense probably benign
Z1188:Zzef1 UTSW 11 72,780,008 (GRCm39) missense probably benign
Z1189:Zzef1 UTSW 11 72,780,008 (GRCm39) missense probably benign
Z1190:Zzef1 UTSW 11 72,780,008 (GRCm39) missense probably benign
Z1191:Zzef1 UTSW 11 72,780,008 (GRCm39) missense probably benign
Z1192:Zzef1 UTSW 11 72,780,008 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTCAGCAACTAGACTGCTACCAC -3'
(R):5'- CAGAATCCTTTCAGAGACGGCTTCC -3'

Sequencing Primer
(F):5'- CATGGTTGTTTTATTACTTACCCAGG -3'
(R):5'- GAGCCACTCTACACTGCTGTG -3'
Posted On 2014-03-28