Incidental Mutation 'R1466:Mroh2b'
ID 166085
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Name maestro heat-like repeat family member 2B
Synonyms 4930455B06Rik, Heatr7b2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R1466 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 4928219-4991687 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 4955166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 720 (D720Y)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
AlphaFold Q7M6Y6
Predicted Effect probably damaging
Transcript: ENSMUST00000045736
AA Change: D720Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: D720Y

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228458
Meta Mutation Damage Score 0.1713 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.9%
  • 10x: 90.8%
  • 20x: 71.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
Adamts12 T C 15: 11,311,445 (GRCm39) F1234S probably benign Het
Ahnak A G 19: 8,993,239 (GRCm39) D4841G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arhgef17 G T 7: 100,578,866 (GRCm39) P694Q possibly damaging Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Aspg A G 12: 112,088,286 (GRCm39) N385D probably benign Het
Atxn3 G A 12: 101,892,758 (GRCm39) R319C possibly damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
C1s1 C T 6: 124,508,090 (GRCm39) C633Y probably damaging Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Cbl A T 9: 44,065,541 (GRCm39) V706E probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cfhr1 C T 1: 139,485,312 (GRCm39) E45K probably benign Het
Chd7 G A 4: 8,840,561 (GRCm39) probably null Het
Chek1 G T 9: 36,637,153 (GRCm39) A2E probably damaging Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Crb2 T C 2: 37,673,400 (GRCm39) Y99H probably damaging Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Cym G A 3: 107,120,774 (GRCm39) T277I probably damaging Het
Cyp2d11 C T 15: 82,275,936 (GRCm39) C215Y probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dnah10 T A 5: 124,840,160 (GRCm39) Y1265N probably benign Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Efhb A G 17: 53,744,206 (GRCm39) F462L probably damaging Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Fat3 A C 9: 16,286,778 (GRCm39) V915G probably damaging Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Galnt4 A G 10: 98,944,571 (GRCm39) R99G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Gm10110 A T 14: 90,135,511 (GRCm39) noncoding transcript Het
Gm4884 A G 7: 40,692,552 (GRCm39) K174E probably damaging Het
Grip2 A T 6: 91,765,424 (GRCm39) D19E probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T A 8: 111,259,585 (GRCm39) V2519E possibly damaging Het
Ints11 G A 4: 155,972,567 (GRCm39) probably null Het
Kif1a A G 1: 92,982,651 (GRCm39) W718R possibly damaging Het
Kif1b A T 4: 149,307,709 (GRCm39) Y839N probably damaging Het
Kif20b T A 19: 34,927,999 (GRCm39) V1047D probably benign Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Klra10 T A 6: 130,256,278 (GRCm39) R125S probably damaging Het
Klra10 T C 6: 130,256,394 (GRCm39) N87D probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Map4k2 G T 19: 6,391,947 (GRCm39) W87L probably damaging Het
Mccc1 A G 3: 36,028,435 (GRCm39) V457A probably benign Het
Mdn1 T A 4: 32,730,788 (GRCm39) S2886T probably benign Het
Mrpl24 T A 3: 87,829,235 (GRCm39) Y21* probably null Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Mtcl1 T A 17: 66,687,430 (GRCm39) D492V probably damaging Het
Muc2 A G 7: 141,302,711 (GRCm39) Y457C probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Myg1 T A 15: 102,245,825 (GRCm39) L275Q probably damaging Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or12d13 A T 17: 37,647,847 (GRCm39) L92H probably benign Het
Or13a18 A G 7: 140,190,882 (GRCm39) I268V probably benign Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pcdh10 T G 3: 45,334,409 (GRCm39) L241R probably damaging Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Ppef1 C A X: 159,408,670 (GRCm39) probably null Het
Prkaa1 C A 15: 5,208,279 (GRCm39) P507T probably benign Het
Ptch1 A G 13: 63,672,783 (GRCm39) Y804H probably benign Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rfx5 T A 3: 94,863,614 (GRCm39) Y88N probably damaging Het
Rnase2b A T 14: 51,400,296 (GRCm39) K126* probably null Het
Rpl3l A G 17: 24,949,845 (GRCm39) I15V probably benign Het
Saal1 G T 7: 46,351,969 (GRCm39) probably null Het
Sbpl A C 17: 24,172,228 (GRCm39) D230E unknown Het
Scn10a T C 9: 119,495,556 (GRCm39) Y322C probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc25a36 A G 9: 96,962,408 (GRCm39) F194L probably damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Slc7a11 G T 3: 50,335,522 (GRCm39) probably null Het
Slco4c1 A T 1: 96,768,897 (GRCm39) S322T probably damaging Het
Smarcc2 A T 10: 128,310,114 (GRCm39) T376S probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Syp A T X: 7,514,944 (GRCm39) probably benign Het
Tas1r2 A G 4: 139,396,722 (GRCm39) D687G probably damaging Het
Tekt4 A T 17: 25,691,048 (GRCm39) Q118L probably benign Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tph2 T C 10: 114,915,600 (GRCm39) N480S probably benign Het
Tsc2 A T 17: 24,827,947 (GRCm39) M839K probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Uaca C T 9: 60,761,603 (GRCm39) A205V possibly damaging Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Zfp704 G T 3: 9,512,408 (GRCm39) T288N possibly damaging Het
Zfp93 T C 7: 23,975,521 (GRCm39) V502A probably damaging Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4,928,679 (GRCm39) missense probably benign
IGL00507:Mroh2b APN 15 4,991,609 (GRCm39) missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4,960,798 (GRCm39) missense probably benign 0.35
IGL00902:Mroh2b APN 15 4,944,704 (GRCm39) missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4,980,609 (GRCm39) splice site probably benign
IGL00954:Mroh2b APN 15 4,932,536 (GRCm39) missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4,971,024 (GRCm39) missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4,944,634 (GRCm39) missense probably benign 0.00
IGL01337:Mroh2b APN 15 4,934,506 (GRCm39) missense probably benign 0.38
IGL01780:Mroh2b APN 15 4,941,482 (GRCm39) missense probably benign 0.01
IGL01919:Mroh2b APN 15 4,953,170 (GRCm39) missense probably benign 0.10
IGL02069:Mroh2b APN 15 4,933,806 (GRCm39) splice site probably benign
IGL02146:Mroh2b APN 15 4,980,776 (GRCm39) splice site probably null
IGL02221:Mroh2b APN 15 4,953,123 (GRCm39) missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4,981,745 (GRCm39) missense probably benign 0.04
IGL02350:Mroh2b APN 15 4,941,482 (GRCm39) missense probably benign 0.01
IGL02357:Mroh2b APN 15 4,941,482 (GRCm39) missense probably benign 0.01
IGL02401:Mroh2b APN 15 4,929,983 (GRCm39) missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4,981,042 (GRCm39) splice site probably benign
IGL02432:Mroh2b APN 15 4,943,668 (GRCm39) missense probably benign
IGL02582:Mroh2b APN 15 4,937,997 (GRCm39) missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4,960,583 (GRCm39) missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4,935,114 (GRCm39) missense probably benign
IGL02811:Mroh2b APN 15 4,944,718 (GRCm39) missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4,991,630 (GRCm39) missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4,973,854 (GRCm39) missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4,942,294 (GRCm39) missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4,955,109 (GRCm39) missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4,960,600 (GRCm39) missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4,971,116 (GRCm39) missense probably benign 0.01
R0530:Mroh2b UTSW 15 4,963,877 (GRCm39) missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4,947,799 (GRCm39) missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4,978,137 (GRCm39) missense probably benign 0.00
R1525:Mroh2b UTSW 15 4,980,612 (GRCm39) splice site probably null
R1584:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4,974,572 (GRCm39) missense probably benign 0.08
R1657:Mroh2b UTSW 15 4,960,525 (GRCm39) nonsense probably null
R1671:Mroh2b UTSW 15 4,980,776 (GRCm39) splice site probably null
R1698:Mroh2b UTSW 15 4,943,622 (GRCm39) missense probably benign 0.02
R2002:Mroh2b UTSW 15 4,955,166 (GRCm39) missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4,946,640 (GRCm39) missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4,974,448 (GRCm39) missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4,950,928 (GRCm39) critical splice donor site probably null
R2183:Mroh2b UTSW 15 4,947,707 (GRCm39) splice site probably null
R3713:Mroh2b UTSW 15 4,973,131 (GRCm39) missense probably benign 0.01
R3714:Mroh2b UTSW 15 4,973,131 (GRCm39) missense probably benign 0.01
R3747:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3748:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3749:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3750:Mroh2b UTSW 15 4,981,728 (GRCm39) nonsense probably null
R3792:Mroh2b UTSW 15 4,953,102 (GRCm39) missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4,954,543 (GRCm39) nonsense probably null
R4021:Mroh2b UTSW 15 4,954,582 (GRCm39) missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4,960,861 (GRCm39) missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4,977,407 (GRCm39) missense probably benign 0.21
R4592:Mroh2b UTSW 15 4,947,772 (GRCm39) missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4,933,752 (GRCm39) missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4,929,932 (GRCm39) missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4,971,004 (GRCm39) missense probably benign 0.07
R5342:Mroh2b UTSW 15 4,943,615 (GRCm39) nonsense probably null
R5353:Mroh2b UTSW 15 4,946,660 (GRCm39) missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4,935,054 (GRCm39) missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4,971,094 (GRCm39) missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4,938,463 (GRCm39) missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4,942,366 (GRCm39) splice site probably null
R6046:Mroh2b UTSW 15 4,980,763 (GRCm39) missense probably benign 0.01
R6081:Mroh2b UTSW 15 4,973,859 (GRCm39) missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4,944,707 (GRCm39) missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4,947,832 (GRCm39) missense probably benign 0.23
R6240:Mroh2b UTSW 15 4,964,126 (GRCm39) missense probably benign 0.38
R6487:Mroh2b UTSW 15 4,976,721 (GRCm39) missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4,935,056 (GRCm39) missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4,982,764 (GRCm39) missense probably benign 0.36
R6663:Mroh2b UTSW 15 4,977,417 (GRCm39) missense probably benign 0.21
R6820:Mroh2b UTSW 15 4,982,756 (GRCm39) missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4,938,469 (GRCm39) missense probably benign 0.00
R6990:Mroh2b UTSW 15 4,942,284 (GRCm39) missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4,929,986 (GRCm39) missense probably benign 0.35
R7092:Mroh2b UTSW 15 4,964,160 (GRCm39) missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4,977,485 (GRCm39) missense probably benign 0.06
R7264:Mroh2b UTSW 15 4,950,844 (GRCm39) missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4,971,036 (GRCm39) missense probably benign 0.21
R7462:Mroh2b UTSW 15 4,938,109 (GRCm39) missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4,978,491 (GRCm39) missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4,964,087 (GRCm39) missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4,960,543 (GRCm39) missense probably benign 0.09
R7605:Mroh2b UTSW 15 4,974,505 (GRCm39) missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4,946,613 (GRCm39) missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4,978,587 (GRCm39) missense probably benign 0.36
R7848:Mroh2b UTSW 15 4,967,861 (GRCm39) nonsense probably null
R7952:Mroh2b UTSW 15 4,980,693 (GRCm39) missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4,950,839 (GRCm39) nonsense probably null
R8088:Mroh2b UTSW 15 4,929,985 (GRCm39) missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4,967,892 (GRCm39) missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4,938,522 (GRCm39) missense probably benign 0.04
R8248:Mroh2b UTSW 15 4,960,586 (GRCm39) missense probably benign 0.40
R8258:Mroh2b UTSW 15 4,941,391 (GRCm39) missense probably benign 0.01
R8259:Mroh2b UTSW 15 4,941,391 (GRCm39) missense probably benign 0.01
R8304:Mroh2b UTSW 15 4,955,119 (GRCm39) missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4,980,746 (GRCm39) nonsense probably null
R8345:Mroh2b UTSW 15 4,973,808 (GRCm39) missense probably benign 0.09
R8507:Mroh2b UTSW 15 4,978,572 (GRCm39) missense probably damaging 1.00
R8728:Mroh2b UTSW 15 4,935,122 (GRCm39) missense probably damaging 1.00
R8747:Mroh2b UTSW 15 4,964,782 (GRCm39) missense probably damaging 0.99
R8798:Mroh2b UTSW 15 4,978,191 (GRCm39) missense probably damaging 1.00
R8814:Mroh2b UTSW 15 4,971,107 (GRCm39) missense possibly damaging 0.61
R8856:Mroh2b UTSW 15 4,960,510 (GRCm39) nonsense probably null
R8910:Mroh2b UTSW 15 4,960,855 (GRCm39) missense probably benign 0.01
R8913:Mroh2b UTSW 15 4,947,010 (GRCm39) intron probably benign
R8941:Mroh2b UTSW 15 4,991,606 (GRCm39) missense possibly damaging 0.86
R9014:Mroh2b UTSW 15 4,928,670 (GRCm39) start codon destroyed probably null 0.95
R9086:Mroh2b UTSW 15 4,982,754 (GRCm39) critical splice acceptor site probably null
R9101:Mroh2b UTSW 15 4,929,935 (GRCm39) missense probably benign 0.20
R9118:Mroh2b UTSW 15 4,991,573 (GRCm39) missense possibly damaging 0.86
R9393:Mroh2b UTSW 15 4,980,666 (GRCm39) missense probably benign
R9429:Mroh2b UTSW 15 4,963,907 (GRCm39) missense probably damaging 1.00
R9431:Mroh2b UTSW 15 4,963,952 (GRCm39) missense probably damaging 1.00
R9443:Mroh2b UTSW 15 4,973,821 (GRCm39) missense probably damaging 1.00
R9447:Mroh2b UTSW 15 4,960,823 (GRCm39) missense probably damaging 1.00
R9497:Mroh2b UTSW 15 4,950,845 (GRCm39) missense probably damaging 0.98
R9588:Mroh2b UTSW 15 4,978,130 (GRCm39) missense probably benign 0.00
R9631:Mroh2b UTSW 15 4,946,556 (GRCm39) missense probably damaging 0.97
R9686:Mroh2b UTSW 15 4,974,605 (GRCm39) missense probably benign 0.34
R9774:Mroh2b UTSW 15 4,943,613 (GRCm39) missense probably benign 0.08
X0067:Mroh2b UTSW 15 4,981,073 (GRCm39) missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4,934,487 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTAACCAACCCTTGTGGTGCTC -3'
(R):5'- ACCTGGTCTGGGAAGTCTCCAAAG -3'

Sequencing Primer
(F):5'- CTTGTGGTGCTCCACCAG -3'
(R):5'- TGGGAAGTCTCCAAAGACTCAG -3'
Posted On 2014-03-28