Mutagenetix > Incidental Mutation

Incidental Mutation 'R1466:Rpl3l'

166101

Institutional Source

Beutler Lab

Gene Symbol

Rpl3l

Ensembl Gene

ENSMUSG00000002500

Gene Name

ribosomal protein L3-like

Synonyms

1110057H16Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R1466 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24727820-24736143 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24730871 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 15 (I15V)

Ref Sequence

ENSEMBL: ENSMUSP00000138489 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045186] [ENSMUST00000170239] [ENSMUST00000183214]

AlphaFold

E9PWZ3

Predicted Effect

probably benign
Transcript: ENSMUST00000045186

SMART Domains

Protein: ENSMUSP00000038326
Gene: ENSMUSG00000002500

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L3	1	181	5.1e-72	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170239
AA Change: I67V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129325
Gene: ENSMUSG00000002500
AA Change: I67V

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L3	1	375	1.2e-178	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183214
AA Change: I15V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000138489
Gene: ENSMUSG00000002500
AA Change: I15V

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L3	1	133	1.1e-43	PFAM

Coding Region Coverage

1x: 99.4%
3x: 97.9%
10x: 90.8%
20x: 71.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares sequence similarity with ribosomal protein L3. The protein belongs to the L3P family of ribosomal proteins. Unlike the ubiquitous expression of ribosomal protein genes, this gene has a tissue-specific pattern of expression, with the highest levels of expression in skeletal muscle and heart. It is not currently known whether the encoded protein is a functional ribosomal protein or whether it has evolved a function that is independent of the ribosome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd15	C	T	11: 77,515,410	A71V	probably damaging	Het
Adamts12	T	C	15: 11,311,359	F1234S	probably benign	Het
Ahnak	A	G	19: 9,015,875	D4841G	probably damaging	Het
Akap13	T	C	7: 75,729,049	S2095P	possibly damaging	Het
Ampd2	T	C	3: 108,080,337		probably null	Het
Arhgef17	G	T	7: 100,929,659	P694Q	possibly damaging	Het
Arrdc1	T	C	2: 24,925,795	I398V	probably benign	Het
Ash1l	T	C	3: 89,052,065	Y2250H	probably damaging	Het
Aspg	A	G	12: 112,121,852	N385D	probably benign	Het
Atxn3	G	A	12: 101,926,499	R319C	possibly damaging	Het
BC005561	T	A	5: 104,518,257	I215N	probably damaging	Het
Brca2	G	A	5: 150,552,258	A2478T	probably damaging	Het
C1s1	C	T	6: 124,531,131	C633Y	probably damaging	Het
C8g	C	T	2: 25,500,216	A6T	probably benign	Het
Cbl	A	T	9: 44,154,244	V706E	probably benign	Het
Cfhr1	C	T	1: 139,557,574	E45K	probably benign	Het
Chd7	G	A	4: 8,840,561		probably null	Het
Chek1	G	T	9: 36,725,857	A2E	probably damaging	Het
Cntnap1	C	A	11: 101,180,360	F366L	probably damaging	Het
Corin	C	T	5: 72,302,790		probably null	Het
Crb2	T	C	2: 37,783,388	Y99H	probably damaging	Het
Ctdspl2	G	A	2: 122,003,929	R332K	probably benign	Het
Cym	G	A	3: 107,213,458	T277I	probably damaging	Het
Cyp2d11	C	T	15: 82,391,735	C215Y	probably benign	Het
Dido1	G	A	2: 180,662,328	P1261L	probably damaging	Het
Dnah10	T	A	5: 124,763,096	Y1265N	probably benign	Het
Dtx3l	G	A	16: 35,932,728	L503F	probably damaging	Het
Efhb	A	G	17: 53,437,178	F462L	probably damaging	Het
Enpep	T	A	3: 129,319,448	T203S	probably damaging	Het
Fat3	A	C	9: 16,375,482	V915G	probably damaging	Het
Fbln7	A	G	2: 128,877,429	T49A	probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fgf14	T	A	14: 124,676,539	K60M	probably benign	Het
Galnt4	A	G	10: 99,108,709	R99G	probably benign	Het
Gimap4	C	A	6: 48,691,282	Q196K	probably benign	Het
Glcci1	C	T	6: 8,537,964	T6I	probably damaging	Het
Gm10110	A	T	14: 89,898,075		noncoding transcript	Het
Gm4884	A	G	7: 41,043,128	K174E	probably damaging	Het
Gm6583	C	T	5: 112,354,764	G358D	probably benign	Het
Grip2	A	T	6: 91,788,443	D19E	probably damaging	Het
Grk4	T	C	5: 34,694,750	S113P	probably benign	Het
Hectd3	G	A	4: 116,996,566	E220K	probably damaging	Het
Helz2	G	A	2: 181,236,297	P903S	probably damaging	Het
Hydin	T	A	8: 110,532,953	V2519E	possibly damaging	Het
Ints11	G	A	4: 155,888,110		probably null	Het
Kif1a	A	G	1: 93,054,929	W718R	possibly damaging	Het
Kif1b	A	T	4: 149,223,252	Y839N	probably damaging	Het
Kif20b	T	A	19: 34,950,599	V1047D	probably benign	Het
Klhl23	T	C	2: 69,833,888	I527T	probably damaging	Het
Klra10	T	A	6: 130,279,315	R125S	probably damaging	Het
Klra10	T	C	6: 130,279,431	N87D	probably damaging	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lcn4	G	A	2: 26,668,576	P166L	probably damaging	Het
Letmd1	T	A	15: 100,472,542		probably null	Het
Map4k2	G	T	19: 6,341,917	W87L	probably damaging	Het
Mccc1	A	G	3: 35,974,286	V457A	probably benign	Het
Mdn1	T	A	4: 32,730,788	S2886T	probably benign	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Mrpl24	T	A	3: 87,921,928	Y21*	probably null	Het
Mrps35	C	T	6: 147,055,984	T169M	probably damaging	Het
Mtcl1	T	A	17: 66,380,435	D492V	probably damaging	Het
Muc2	A	G	7: 141,748,974	Y457C	probably damaging	Het
Muc4	G	A	16: 32,753,595	G1157D	probably benign	Het
Myg1	T	A	15: 102,337,390	L275Q	probably damaging	Het
Naga	T	A	15: 82,334,788	M237L	probably null	Het
Oc90	T	A	15: 65,897,720	Y96F	probably damaging	Het
Olfr1029	T	A	2: 85,975,995	F251I	probably damaging	Het
Olfr103	A	T	17: 37,336,956	L92H	probably benign	Het
Olfr1253	C	T	2: 89,752,267	C187Y	probably damaging	Het
Olfr46	A	G	7: 140,610,969	I268V	probably benign	Het
Olfr522	A	G	7: 140,162,203	V249A	probably damaging	Het
Orc4	A	T	2: 48,909,494	C324S	possibly damaging	Het
Pcdh10	T	G	3: 45,379,974	L241R	probably damaging	Het
Pdzrn4	T	C	15: 92,770,537	S857P	probably benign	Het
Plec	C	T	15: 76,185,908	E1000K	possibly damaging	Het
Plvap	A	T	8: 71,508,481	V149D	probably benign	Het
Ppef1	C	A	X: 160,625,674		probably null	Het
Prkaa1	C	A	15: 5,178,798	P507T	probably benign	Het
Ptch1	A	G	13: 63,524,969	Y804H	probably benign	Het
R3hdm2	A	G	10: 127,476,690	I434V	probably benign	Het
Rfx5	T	A	3: 94,956,303	Y88N	probably damaging	Het
Rnase2b	A	T	14: 51,162,839	K126*	probably null	Het
Saal1	G	T	7: 46,702,545		probably null	Het
Sbpl	A	C	17: 23,953,254	D230E	unknown	Het
Scn10a	T	C	9: 119,666,490	Y322C	probably damaging	Het
Sec16a	A	T	2: 26,431,157	Y1308N	probably damaging	Het
Sis	A	T	3: 72,932,060	D824E	possibly damaging	Het
Slc25a36	A	G	9: 97,080,355	F194L	probably damaging	Het
Slc27a4	T	A	2: 29,811,190	V331E	probably damaging	Het
Slc7a11	G	T	3: 50,381,073		probably null	Het
Slco4c1	A	T	1: 96,841,172	S322T	probably damaging	Het
Smarcc2	A	T	10: 128,474,245	T376S	probably damaging	Het
Srebf1	C	T	11: 60,200,702	R999H	probably benign	Het
St3gal3	A	C	4: 118,107,662	M1R	probably null	Het
Syp	A	T	X: 7,648,705		probably benign	Het
Tas1r2	A	G	4: 139,669,411	D687G	probably damaging	Het
Tekt4	A	T	17: 25,472,074	Q118L	probably benign	Het
Tph2	T	C	10: 115,079,695	N480S	probably benign	Het
Tsc2	A	T	17: 24,608,973	M839K	probably damaging	Het
Ttc22	T	C	4: 106,622,780	F77S	probably damaging	Het
Uaca	C	T	9: 60,854,321	A205V	possibly damaging	Het
Uhmk1	A	T	1: 170,208,653		probably null	Het
Usp17lc	A	G	7: 103,418,941	H481R	possibly damaging	Het
Vwa3a	A	G	7: 120,768,165	Y181C	probably damaging	Het
Wfikkn2	G	A	11: 94,238,895	T140I	probably damaging	Het
Zfp704	G	T	3: 9,447,348	T288N	possibly damaging	Het
Zfp93	T	C	7: 24,276,096	V502A	probably damaging	Het
Zzef1	C	T	11: 72,924,679	P2942S	probably damaging	Het

Other mutations in Rpl3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00984:Rpl3l	APN	17	24735471	missense	probably damaging	0.96
IGL01364:Rpl3l	APN	17	24732430	missense	probably benign	0.07
IGL02009:Rpl3l	APN	17	24732433	missense	probably damaging	0.98
IGL02422:Rpl3l	APN	17	24733988	nonsense	probably null
IGL03309:Rpl3l	APN	17	24736024	missense	possibly damaging	0.64
stringer	UTSW	17	24735481	missense	probably damaging	1.00
PIT4468001:Rpl3l	UTSW	17	24735483	missense	probably benign	0.00
R1466:Rpl3l	UTSW	17	24730871	missense	probably benign
R1782:Rpl3l	UTSW	17	24733456	missense	probably benign	0.02
R2019:Rpl3l	UTSW	17	24735516	unclassified	probably benign
R2509:Rpl3l	UTSW	17	24732386	missense	possibly damaging	0.94
R3844:Rpl3l	UTSW	17	24733942	missense	probably benign	0.02
R4574:Rpl3l	UTSW	17	24734010	missense	possibly damaging	0.70
R4675:Rpl3l	UTSW	17	24733610	missense	probably benign	0.43
R5097:Rpl3l	UTSW	17	24733461	missense	probably damaging	1.00
R5106:Rpl3l	UTSW	17	24732437	missense	probably damaging	1.00
R5187:Rpl3l	UTSW	17	24732455	missense	possibly damaging	0.95
R6073:Rpl3l	UTSW	17	24730887	missense	probably benign
R6295:Rpl3l	UTSW	17	24733992	missense	probably benign
R7624:Rpl3l	UTSW	17	24732427	missense	probably benign
R7655:Rpl3l	UTSW	17	24730986	missense	probably benign	0.37
R7656:Rpl3l	UTSW	17	24730986	missense	probably benign	0.37
R7834:Rpl3l	UTSW	17	24733463	missense	possibly damaging	0.58
R8527:Rpl3l	UTSW	17	24735780	missense	probably damaging	1.00
R8542:Rpl3l	UTSW	17	24735780	missense	probably damaging	1.00
R8792:Rpl3l	UTSW	17	24728473	missense	possibly damaging	0.73
R8840:Rpl3l	UTSW	17	24733737	missense	probably damaging	0.99
R8867:Rpl3l	UTSW	17	24735481	missense	probably damaging	1.00
R9046:Rpl3l	UTSW	17	24728461	missense	probably damaging	1.00
R9258:Rpl3l	UTSW	17	24732473	critical splice donor site	probably null
R9436:Rpl3l	UTSW	17	24728326	nonsense	probably null
R9651:Rpl3l	UTSW	17	24728354	missense	probably damaging	1.00
R9652:Rpl3l	UTSW	17	24728354	missense	probably damaging	1.00
Z1177:Rpl3l	UTSW	17	24728398	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACAAACTCCAAAGTTTATGGTGGCCT -3'
(R):5'- TGTTCTTTCCTGTCCTGCTGAATGAAG -3'

Sequencing Primer
(F):5'- GTGGCCTAACTACAGTTAGCCAG -3'
(R):5'- TCCTGCTGAATGAAGGCACC -3'

Posted On

2014-03-28