Incidental Mutation 'R0119:Mug2'
ID166116
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Namemurinoglobulin 2
Synonyms
MMRRC Submission 038405-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0119 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location122006761-122085965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122036063 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 311 (H311Q)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
Predicted Effect probably benign
Transcript: ENSMUST00000081777
AA Change: H311Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: H311Q

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204290
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adamts18 A G 8: 113,774,953 I346T possibly damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap3d1 A G 10: 80,723,615 probably benign Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Cap1 A T 4: 122,867,699 L130Q probably damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Caskin2 A G 11: 115,802,427 probably benign Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Cd96 T C 16: 46,038,579 probably benign Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1c A T 8: 93,106,717 probably benign Het
Ces1c A T 8: 93,107,610 L351M probably benign Het
Cnih3 T A 1: 181,454,744 probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Cry1 A G 10: 85,133,240 probably null Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Defb13 T C 8: 21,946,861 probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Elmo3 T C 8: 105,309,768 L668S probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Gm839 A T 6: 89,212,380 noncoding transcript Het
Gng5 T A 3: 146,503,293 C39S probably damaging Het
Gpr55 C T 1: 85,941,424 W145* probably null Het
Hdlbp A C 1: 93,421,337 probably benign Het
Man2a2 G T 7: 80,367,405 N305K probably damaging Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mier3 T C 13: 111,715,038 V490A probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Obox3 T A 7: 15,626,327 probably null Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pcdh15 T C 10: 74,170,575 F95S probably damaging Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Per3 A G 4: 151,024,548 probably benign Het
Pip4k2b A T 11: 97,722,936 probably benign Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Rere T G 4: 150,615,322 probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Sh3bgrl3 A T 4: 134,128,036 I33N probably damaging Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Sppl3 T A 5: 115,088,994 probably benign Het
Tacc2 C A 7: 130,621,875 Q116K probably damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tnpo3 A G 6: 29,568,922 V477A possibly damaging Het
Trim7 G T 11: 48,849,712 R212L probably damaging Het
Trpm6 T A 19: 18,832,593 C1118S probably benign Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Zbtb18 A G 1: 177,448,157 E361G probably benign Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122071011 splice site probably benign
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1104:Mug2 UTSW 6 122059055 missense probably benign
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4227:Mug2 UTSW 6 122040732 missense probably benign 0.10
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4419:Mug2 UTSW 6 122079630 missense probably damaging 1.00
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122047487 missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7581:Mug2 UTSW 6 122063711 missense probably damaging 1.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7834:Mug2 UTSW 6 122036282 missense probably benign
R7850:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R7917:Mug2 UTSW 6 122036282 missense probably benign
R7933:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R8029:Mug2 UTSW 6 122081545
Z1177:Mug2 UTSW 6 122037121
Predicted Primers PCR Primer
(F):5'- GCATACATGAGCCCAGGGTTTGAG -3'
(R):5'- CCCATGTCTGAAGTGTGAATCTGCC -3'

Sequencing Primer
(F):5'- GAGCTGAGTCCCATGCTTATAAC -3'
(R):5'- TTGAACTCCAGTCCTGAAGAAG -3'
Posted On2014-04-02