Incidental Mutation 'R0079:Olfr1564'
ID166152
Institutional Source Beutler Lab
Gene Symbol Olfr1564
Ensembl Gene ENSMUSG00000096169
Gene Nameolfactory receptor 1564
SynonymsGm4461
MMRRC Submission 038366-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R0079 (G1)
Quality Score83
Status Validated
Chromosome17
Chromosomal Location33211206-33221690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33216105 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 80 (R80C)
Ref Sequence ENSEMBL: ENSMUSP00000150573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112162] [ENSMUST00000208645] [ENSMUST00000213642] [ENSMUST00000213751] [ENSMUST00000215450]
Predicted Effect probably benign
Transcript: ENSMUST00000112162
AA Change: R83C

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127247
Gene: ENSMUSG00000096169
AA Change: R83C

DomainStartEndE-ValueType
Pfam:7tm_4 34 312 3.3e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 263 1.5e-5 PFAM
Pfam:7tm_1 44 297 5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208645
AA Change: R80C

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000213642
AA Change: R80C

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000213751
AA Change: R80C

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000215450
AA Change: R80C

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
Meta Mutation Damage Score 0.1900 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency 78% (155/199)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,007,182 T105S possibly damaging Het
Abca13 G A 11: 9,293,493 M1785I probably benign Het
Adamts3 G C 5: 89,693,053 P804A probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ank2 G T 3: 126,934,615 D776E probably benign Het
Cep152 T A 2: 125,618,453 K193M possibly damaging Het
Cep55 C T 19: 38,060,321 L142F probably benign Het
Chd5 A G 4: 152,385,749 Y1884C probably damaging Het
Clasp1 T C 1: 118,543,304 L890P probably damaging Het
Cul9 C A 17: 46,537,663 E716* probably null Het
Cytip T A 2: 58,159,994 D21V probably benign Het
Denr T G 5: 123,924,845 F137C probably damaging Het
Dhrs3 A T 4: 144,920,048 S197C probably damaging Het
Egr4 A T 6: 85,512,769 M103K probably damaging Het
Eif4enif1 C T 11: 3,242,676 Q835* probably null Het
Gckr A G 5: 31,306,539 I268V probably benign Het
Glt6d1 C A 2: 25,794,727 probably null Het
Hpd T C 5: 123,181,481 Y8C probably damaging Het
Il12rb2 A T 6: 67,361,905 F16I probably benign Het
Ildr2 A T 1: 166,307,720 Y347F probably damaging Het
Kcnv1 T C 15: 45,113,333 D186G probably damaging Het
Khdrbs2 A G 1: 32,519,915 probably null Het
L1cam G T X: 73,869,758 P16H probably damaging Het
Lyn A G 4: 3,746,768 H161R probably damaging Het
Mctp2 T A 7: 72,214,116 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mitf A C 6: 97,996,440 M220L probably benign Het
Mrpl21 T C 19: 3,284,807 Y50H possibly damaging Het
Myh1 T A 11: 67,213,411 L968Q probably damaging Het
Myo3b A G 2: 70,095,158 K18E possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nlrp2 T A 7: 5,327,730 T556S possibly damaging Het
Nsmf T C 2: 25,059,084 probably benign Het
Nsun7 C T 5: 66,295,513 P558S probably benign Het
Olfr1168 A T 2: 88,185,354 Y159F possibly damaging Het
Olfr394 T G 11: 73,887,737 I212L probably benign Het
Olfr679 T C 7: 105,085,928 S71P probably damaging Het
Papd5 T A 8: 88,200,003 Y14N possibly damaging Het
Phf19 T C 2: 34,895,954 N501S probably benign Het
Ranbp17 A C 11: 33,500,682 I85S probably damaging Het
Robo1 A G 16: 72,933,342 probably benign Het
Sntg1 A G 1: 8,679,062 probably benign Het
Snx15 A G 19: 6,123,913 L58P probably damaging Het
Spink5 G T 18: 43,977,764 C134F probably damaging Het
Strip2 T C 6: 29,920,533 probably null Het
Taf1d C T 9: 15,309,944 A182V probably benign Het
Tenm3 A G 8: 48,343,345 V475A possibly damaging Het
Tgds A T 14: 118,116,235 H223Q possibly damaging Het
Thoc2 G T X: 41,864,108 S230Y probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Trak2 A T 1: 58,926,724 L97Q probably damaging Het
Trnau1ap A G 4: 132,314,345 Y145H probably damaging Het
Vars2 A T 17: 35,659,156 D780E probably damaging Het
Vmn1r170 T A 7: 23,606,310 S46T possibly damaging Het
Vmn1r20 A T 6: 57,431,792 R34S possibly damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdr64 T C 1: 175,795,102 M805T probably benign Het
Xdh G A 17: 73,891,218 R1225C probably damaging Het
Zfp341 T A 2: 154,624,994 Y94* probably null Het
Zfp641 T C 15: 98,289,089 N218D probably benign Het
Zscan22 T C 7: 12,904,087 probably null Het
Other mutations in Olfr1564
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Olfr1564 APN 17 33215973 missense probably benign 0.41
R0939:Olfr1564 UTSW 17 33215661 missense possibly damaging 0.72
R1279:Olfr1564 UTSW 17 33216326 missense possibly damaging 0.59
R2167:Olfr1564 UTSW 17 33215568 missense probably damaging 0.97
R2866:Olfr1564 UTSW 17 33216278 missense probably benign 0.22
R4738:Olfr1564 UTSW 17 33215810 missense probably benign 0.03
R4976:Olfr1564 UTSW 17 33215754 missense probably benign 0.35
R6452:Olfr1564 UTSW 17 33215945 missense probably benign 0.03
R6721:Olfr1564 UTSW 17 33215534 missense probably benign
R7322:Olfr1564 UTSW 17 33215699 missense probably damaging 1.00
R8032:Olfr1564 UTSW 17 33215950 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCTGTGATGCACACTATTCCTACACC -3'
(R):5'- GCTGTCATGTTGGGGCTAAATTACACC -3'

Sequencing Primer
(F):5'- CATGCCAACTTCAATAGAGGTG -3'
(R):5'- GGGCTAAATTACACCTTTGTGTCAG -3'
Posted On2014-04-09