Incidental Mutation 'R0271:Hspa1b'
ID166158
Institutional Source Beutler Lab
Gene Symbol Hspa1b
Ensembl Gene ENSMUSG00000090877
Gene Nameheat shock protein 1B
SynonymsHsp70-1, hsp68, HSP70A1, Hsp70, Hsp70.1
MMRRC Submission 038497-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.693) question?
Stock #R0271 (G1)
Quality Score64
Status Validated
Chromosome17
Chromosomal Location34956436-34959238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34958832 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 59 (V59A)
Ref Sequence ENSEMBL: ENSMUSP00000133815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172753]
Predicted Effect probably benign
Transcript: ENSMUST00000172753
AA Change: V59A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133815
Gene: ENSMUSG00000090877
AA Change: V59A

DomainStartEndE-ValueType
Pfam:HSP70 6 612 1.3e-268 PFAM
low complexity region 613 631 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174777
Meta Mutation Damage Score 0.0982 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased susceptibility to focal cerebral ischemic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,686,329 probably benign Het
4930544D05Rik A G 11: 70,616,648 Q173R possibly damaging Het
Ampd2 C T 3: 108,086,716 probably benign Het
Ankrd17 T C 5: 90,254,799 S1467G possibly damaging Het
Arhgap31 T G 16: 38,602,510 S1065R possibly damaging Het
Arhgef19 G T 4: 141,250,607 M542I probably benign Het
C7 T C 15: 5,015,380 D392G possibly damaging Het
Ccdc138 G A 10: 58,575,823 C671Y probably damaging Het
Cdh8 A G 8: 99,111,715 S498P possibly damaging Het
Cpb2 T A 14: 75,257,709 probably null Het
Cwc22 A C 2: 77,920,858 N389K probably benign Het
Dgkb T A 12: 38,228,026 L550Q probably damaging Het
Dip2c A G 13: 9,615,775 R950G probably damaging Het
Eml6 A G 11: 29,848,949 V437A possibly damaging Het
Fanca T C 8: 123,272,441 probably benign Het
Fgd2 C G 17: 29,367,008 L189V possibly damaging Het
Foxred2 A C 15: 77,943,390 S590A possibly damaging Het
Gm1110 A G 9: 26,920,666 F63S probably damaging Het
Gm14496 A T 2: 181,995,954 M274L probably benign Het
Gm7008 T A 12: 40,223,560 probably benign Het
Gm9922 T A 14: 101,729,553 probably benign Het
Gtf3c3 A T 1: 54,428,812 M222K possibly damaging Het
Impg1 T C 9: 80,386,879 probably benign Het
Lpcat4 T A 2: 112,243,245 probably null Het
Mipol1 T C 12: 57,460,954 probably benign Het
Mrpl37 C A 4: 107,066,461 R112L possibly damaging Het
Myo18b T C 5: 112,809,685 N1471D possibly damaging Het
Nes G A 3: 87,978,642 E1359K possibly damaging Het
Nipbl A T 15: 8,361,737 V251E possibly damaging Het
Nlrp1b T C 11: 71,161,765 I946V possibly damaging Het
Obscn T G 11: 59,056,742 probably benign Het
Olfr1024 A T 2: 85,904,289 M255K possibly damaging Het
Olfr1239 T A 2: 89,418,158 Y85F probably benign Het
Olfr1491 A T 19: 13,705,135 T103S probably benign Het
Olfr635 T A 7: 103,979,630 I146K possibly damaging Het
Pck2 T C 14: 55,544,584 probably null Het
Pcsk9 A G 4: 106,449,049 probably benign Het
Phyhd1 A T 2: 30,269,822 Q56L probably benign Het
Plxnc1 C T 10: 94,837,918 G1001S probably null Het
Prss52 T C 14: 64,113,678 V304A probably benign Het
Prss55 C T 14: 64,075,607 G276D probably benign Het
Pzp A T 6: 128,519,514 Y252N probably damaging Het
Rad1 T C 15: 10,490,457 probably null Het
Ripply3 A T 16: 94,335,757 E92D possibly damaging Het
Rpp30 T A 19: 36,104,403 D255E probably benign Het
Rsad1 T C 11: 94,548,464 probably benign Het
Serpini2 A G 3: 75,246,578 M358T probably damaging Het
Slc35a1 T A 4: 34,664,125 E331V probably benign Het
Slc38a7 A G 8: 95,845,878 F179L probably damaging Het
Stmn4 C T 14: 66,356,283 Q42* probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tab2 G A 10: 7,919,158 A520V probably benign Het
Tcp10a A G 17: 7,331,156 I162M probably benign Het
Tmprss13 A G 9: 45,333,688 probably benign Het
Tnfrsf14 A G 4: 154,926,597 probably null Het
Tpx2 A G 2: 152,867,367 probably benign Het
Vmn2r105 T A 17: 20,234,703 N57I probably damaging Het
Wars C T 12: 108,875,193 V220I probably benign Het
Washc1 T A 17: 66,116,719 D212E possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr43 A G 17: 71,626,825 D139G probably benign Het
Zfp235 A T 7: 24,137,131 H34L possibly damaging Het
Zkscan16 G A 4: 58,952,391 V230I probably benign Het
Other mutations in Hspa1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Hspa1b APN 17 34957549 missense probably benign 0.31
FR4548:Hspa1b UTSW 17 34957129 small deletion probably benign
FR4737:Hspa1b UTSW 17 34957129 small deletion probably benign
R0843:Hspa1b UTSW 17 34957548 missense possibly damaging 0.88
R2679:Hspa1b UTSW 17 34957303 missense probably benign 0.09
R5007:Hspa1b UTSW 17 34958110 missense probably benign 0.08
R5121:Hspa1b UTSW 17 34958004 missense possibly damaging 0.89
R5261:Hspa1b UTSW 17 34959007 start codon destroyed probably null
R6076:Hspa1b UTSW 17 34957497 missense probably damaging 1.00
R6523:Hspa1b UTSW 17 34957191 missense probably benign 0.42
R6823:Hspa1b UTSW 17 34958185 missense probably benign 0.02
R7536:Hspa1b UTSW 17 34958875 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TGCCGCTGAGAGTCGTTGAAGTAG -3'
(R):5'- GGTTCCATCCAGAGACAAGCGAAG -3'

Sequencing Primer
(F):5'- TGATCACCGCGTTGGTCAC -3'
(R):5'- GCAGCCTTCCAGAAGCAG -3'
Posted On2014-04-09