Incidental Mutation 'R0013:Mroh4'
ID166164
Institutional Source Beutler Lab
Gene Symbol Mroh4
Ensembl Gene ENSMUSG00000022603
Gene Namemaestro heat-like repeat family member 4
Synonyms1700016M24Rik
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0013 (G1)
Quality Score45
Status Validated
Chromosome15
Chromosomal Location74606029-74636353 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 74608237 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023271] [ENSMUST00000137963]
Predicted Effect probably benign
Transcript: ENSMUST00000023271
SMART Domains Protein: ENSMUSP00000023271
Gene: ENSMUSG00000022603

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 428 435 N/A INTRINSIC
low complexity region 520 534 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
SCOP:d1ee4a_ 709 852 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137963
SMART Domains Protein: ENSMUSP00000117011
Gene: ENSMUSG00000022603

DomainStartEndE-ValueType
low complexity region 257 268 N/A INTRINSIC
low complexity region 359 366 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 503 522 N/A INTRINSIC
SCOP:d1ee4a_ 640 783 3e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177179
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Adnp2 A T 18: 80,129,745 V483D probably damaging Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Agl A T 3: 116,776,608 C911* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Antxr2 A G 5: 97,979,985 V229A probably damaging Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Dchs1 T A 7: 105,755,836 T2500S possibly damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dhx33 A T 11: 70,993,635 F448L probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Dnmbp G A 19: 43,902,231 P366S probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Grm4 A G 17: 27,431,575 Y816H probably benign Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kdm5d A T Y: 941,715 K1305N probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mboat7 A G 7: 3,683,822 S340P probably damaging Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Olfr980 A T 9: 40,006,355 I198N probably damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Plekhg4 G T 8: 105,375,396 E6* probably null Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Uba7 A T 9: 107,978,249 Y375F probably damaging Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Zfp839 T A 12: 110,868,386 S692T possibly damaging Het
Other mutations in Mroh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Mroh4 APN 15 74611358 splice site probably benign
IGL02370:Mroh4 APN 15 74625541 missense probably benign 0.00
IGL02598:Mroh4 APN 15 74611243 critical splice donor site probably null
IGL02644:Mroh4 APN 15 74610375 missense possibly damaging 0.90
IGL02666:Mroh4 APN 15 74609775 missense probably benign 0.04
IGL02723:Mroh4 APN 15 74608237 splice site probably benign
IGL02724:Mroh4 APN 15 74606151 missense probably benign 0.00
IGL03000:Mroh4 APN 15 74616114 missense probably benign
IGL03103:Mroh4 APN 15 74616159 missense possibly damaging 0.47
IGL03194:Mroh4 APN 15 74611539 missense probably damaging 1.00
R0042:Mroh4 UTSW 15 74610305 missense probably damaging 0.99
R0042:Mroh4 UTSW 15 74610305 missense probably damaging 0.99
R0294:Mroh4 UTSW 15 74606149 missense probably benign
R0346:Mroh4 UTSW 15 74614292 splice site probably benign
R0545:Mroh4 UTSW 15 74625427 missense probably benign 0.00
R0688:Mroh4 UTSW 15 74606678 missense probably damaging 0.98
R1838:Mroh4 UTSW 15 74616113 missense probably benign 0.03
R2037:Mroh4 UTSW 15 74609761 missense possibly damaging 0.91
R4725:Mroh4 UTSW 15 74616107 missense probably damaging 0.99
R4786:Mroh4 UTSW 15 74610234 missense probably benign 0.08
R4798:Mroh4 UTSW 15 74626179 missense probably damaging 1.00
R4945:Mroh4 UTSW 15 74612008 missense probably benign 0.00
R5065:Mroh4 UTSW 15 74628270 splice site probably null
R5476:Mroh4 UTSW 15 74611661 missense probably benign 0.15
R5509:Mroh4 UTSW 15 74606154 missense probably benign 0.00
R5527:Mroh4 UTSW 15 74615016 missense probably damaging 1.00
R5662:Mroh4 UTSW 15 74625428 missense possibly damaging 0.63
R5818:Mroh4 UTSW 15 74611982 missense probably damaging 0.98
R5861:Mroh4 UTSW 15 74606607 intron probably benign
R5886:Mroh4 UTSW 15 74606447 missense possibly damaging 0.90
R5935:Mroh4 UTSW 15 74621154 missense probably damaging 1.00
R6008:Mroh4 UTSW 15 74625472 nonsense probably null
R6658:Mroh4 UTSW 15 74621129 missense possibly damaging 0.83
R6689:Mroh4 UTSW 15 74612003 missense probably damaging 1.00
R6739:Mroh4 UTSW 15 74609719 missense probably benign 0.10
R6888:Mroh4 UTSW 15 74613249 missense possibly damaging 0.93
R7088:Mroh4 UTSW 15 74626144 missense probably benign 0.25
R7260:Mroh4 UTSW 15 74608129 missense possibly damaging 0.83
R7365:Mroh4 UTSW 15 74610371 nonsense probably null
R7735:Mroh4 UTSW 15 74625508 missense probably damaging 0.98
R7763:Mroh4 UTSW 15 74624705 missense probably damaging 0.99
R7945:Mroh4 UTSW 15 74624705 missense probably damaging 0.99
R8090:Mroh4 UTSW 15 74624701 missense probably benign 0.41
R8242:Mroh4 UTSW 15 74616308 missense possibly damaging 0.47
Z1177:Mroh4 UTSW 15 74627720 missense probably damaging 1.00
Z1177:Mroh4 UTSW 15 74628002 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCAGAAAGCTCGGAGGTGACTGTG -3'
(R):5'- TCTCCCAGGCTTCCAAGAGTAAGAC -3'

Sequencing Primer
(F):5'- TGTGCAGCCACCACACC -3'
(R):5'- ttaacaatccaaatgtagcccag -3'
Posted On2014-04-10