Incidental Mutation 'R1531:Speg'
ID166166
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene NameSPEG complex locus
SynonymsSPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG
MMRRC Submission 039570-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1531 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75375297-75432320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75401222 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 769 (T769A)
Ref Sequence ENSEMBL: ENSMUSP00000109220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000113587] [ENSMUST00000113588] [ENSMUST00000113589] [ENSMUST00000113590] [ENSMUST00000122266]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087122
AA Change: T875A

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: T875A

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113587
AA Change: T21A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109217
Gene: ENSMUSG00000026207
AA Change: T21A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113588
AA Change: T21A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109218
Gene: ENSMUSG00000026207
AA Change: T21A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113589
AA Change: T21A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109219
Gene: ENSMUSG00000026207
AA Change: T21A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113590
AA Change: T769A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207
AA Change: T769A

DomainStartEndE-ValueType
low complexity region 186 212 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 253 262 N/A INTRINSIC
low complexity region 306 317 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
IGc2 633 700 2.19e-9 SMART
low complexity region 752 764 N/A INTRINSIC
IGc2 780 848 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122266
AA Change: T21A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113646
Gene: ENSMUSG00000026207
AA Change: T21A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132100
Predicted Effect unknown
Transcript: ENSMUST00000137868
AA Change: T622A
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A G 10: 43,525,320 V211A probably benign Het
Agtpbp1 T A 13: 59,500,634 probably null Het
Aldh3b2 T G 19: 3,977,543 F28C probably damaging Het
Apaf1 T C 10: 91,054,521 N540S probably damaging Het
Apob T C 12: 7,997,880 I953T possibly damaging Het
Arhgef1 A G 7: 24,924,998 T816A probably damaging Het
Arid4a T A 12: 71,076,005 F1053L probably benign Het
Atxn1l A C 8: 109,732,059 F524V probably damaging Het
Cad T A 5: 31,076,219 M1874K probably benign Het
Ccdc40 G A 11: 119,263,189 V1096I probably benign Het
Ccdc93 A G 1: 121,480,822 D358G probably benign Het
Cd96 T C 16: 46,117,806 T99A probably benign Het
Cdc42ep3 A T 17: 79,335,044 M149K probably benign Het
Cog4 A G 8: 110,879,721 E613G probably benign Het
Crebbp A T 16: 4,084,517 I2286N probably benign Het
Csf1 T C 3: 107,748,338 E459G possibly damaging Het
Csrp2 A T 10: 110,935,205 Y57F probably benign Het
Ctdspl C T 9: 119,040,582 P244L probably damaging Het
Cyp2c29 A G 19: 39,324,968 R303G probably damaging Het
Cyp4a10 C A 4: 115,518,435 Y38* probably null Het
Dmgdh T A 13: 93,744,411 I783N probably damaging Het
Efcc1 G A 6: 87,731,166 E92K probably benign Het
Eif2ak4 T A 2: 118,443,210 L872H probably damaging Het
Elp2 T A 18: 24,631,404 S603T probably benign Het
Eml2 T A 7: 19,196,254 L300H probably damaging Het
Esp3 A G 17: 40,635,936 K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 F136L probably damaging Het
Exoc1 T A 5: 76,559,164 D497E probably damaging Het
Fat3 A G 9: 15,997,465 S2414P probably damaging Het
Foxj3 C T 4: 119,620,201 P369S unknown Het
Gkn2 G T 6: 87,375,939 probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gm21905 A T 5: 67,946,381 probably benign Het
Grhl1 T A 12: 24,582,963 probably null Het
Grk6 A G 13: 55,452,154 Y221C probably damaging Het
Hcrtr1 T A 4: 130,130,927 K389* probably null Het
Hk1 G A 10: 62,284,784 R545C probably damaging Het
Hsp90b1 A T 10: 86,696,795 I339N probably benign Het
Ikzf3 T C 11: 98,490,446 R103G probably damaging Het
Itgad A C 7: 128,178,370 I141L probably benign Het
Jmjd6 T A 11: 116,842,440 Y137F probably benign Het
Kcna1 A G 6: 126,642,067 V430A probably benign Het
Kel A G 6: 41,688,626 V520A probably damaging Het
Klhl41 G A 2: 69,670,740 V182I probably benign Het
Ldhb C A 6: 142,501,395 M64I probably benign Het
Lrrc23 A G 6: 124,776,114 S190P possibly damaging Het
Mb21d1 A G 9: 78,442,481 Y200H probably damaging Het
Mboat2 T C 12: 24,959,030 V445A probably benign Het
Mlycd G A 8: 119,401,519 W188* probably null Het
Mpp3 C T 11: 102,008,649 E349K probably benign Het
Myh4 A G 11: 67,250,540 M780V probably benign Het
Myh6 G A 14: 54,956,506 R809C probably damaging Het
Mylip G A 13: 45,406,570 V161M possibly damaging Het
Nrp1 G A 8: 128,425,969 V220I probably null Het
Nup210 A T 6: 91,034,841 N455K probably benign Het
Olfr116 A T 17: 37,624,352 Y94* probably null Het
Olfr583 C A 7: 103,051,588 Q97K probably benign Het
Pbld2 G T 10: 63,053,953 probably null Het
Pclo C G 5: 14,521,903 P434R probably damaging Het
Pdlim3 A G 8: 45,896,763 K37E probably damaging Het
Prkdc T A 16: 15,772,106 I2611N probably benign Het
Prr12 T C 7: 45,028,530 D2019G unknown Het
Rab27a A G 9: 73,095,403 T205A probably benign Het
Rcan3 A G 4: 135,425,284 L42P probably damaging Het
Rchy1 T C 5: 91,955,615 probably null Het
Sema6a T C 18: 47,248,999 H827R probably damaging Het
Sertad4 A G 1: 192,850,950 probably null Het
Smarcd1 T A 15: 99,707,383 C282S probably damaging Het
Syne1 T A 10: 5,347,875 K1141* probably null Het
Synpo2 T C 3: 123,117,666 E110G probably benign Het
Tg T A 15: 66,850,502 D333E probably benign Het
Tmem132c A G 5: 127,359,891 Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 V14E probably damaging Het
Tmem229b A G 12: 78,964,911 L82P probably damaging Het
Togaram1 A G 12: 64,966,265 T97A probably benign Het
Trappc9 G A 15: 72,693,548 R965* probably null Het
Trio T C 15: 27,832,985 I104V probably benign Het
Trp73 A G 4: 154,063,895 F354S probably benign Het
Ttyh2 T C 11: 114,686,452 L63P probably damaging Het
Ulk4 G C 9: 121,044,775 P1197A probably damaging Het
Vmn1r176 T C 7: 23,835,111 M206V possibly damaging Het
Vps8 T A 16: 21,466,476 Y402* probably null Het
Zbtb41 A G 1: 139,423,193 I15V probably benign Het
Zc3hav1 T C 6: 38,307,235 I982V possibly damaging Het
Zmynd19 T A 2: 24,958,111 N106K probably benign Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75410390 missense possibly damaging 0.95
IGL00979:Speg APN 1 75410734 missense probably damaging 0.98
IGL01122:Speg APN 1 75410035 missense probably damaging 1.00
IGL01293:Speg APN 1 75388102 missense probably damaging 1.00
IGL01304:Speg APN 1 75428197 missense probably benign 0.00
IGL01351:Speg APN 1 75411276 splice site probably benign
IGL01473:Speg APN 1 75428285 missense possibly damaging 0.53
IGL01477:Speg APN 1 75391897 missense probably damaging 1.00
IGL01485:Speg APN 1 75387827 missense probably damaging 1.00
IGL01584:Speg APN 1 75430937 missense probably damaging 1.00
IGL01959:Speg APN 1 75391090 missense probably damaging 1.00
IGL02231:Speg APN 1 75423387 missense probably damaging 1.00
IGL02355:Speg APN 1 75423915 missense possibly damaging 0.49
IGL02362:Speg APN 1 75423915 missense possibly damaging 0.49
IGL03013:Speg APN 1 75431279 missense probably damaging 0.97
IGL03168:Speg APN 1 75388187 missense probably damaging 1.00
H8562:Speg UTSW 1 75415597 missense probably benign 0.39
R0112:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0311:Speg UTSW 1 75430937 missense probably damaging 1.00
R0315:Speg UTSW 1 75415136 missense possibly damaging 0.88
R0393:Speg UTSW 1 75423924 missense possibly damaging 0.46
R0403:Speg UTSW 1 75430784 splice site probably benign
R0483:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0648:Speg UTSW 1 75427978 missense probably benign
R0683:Speg UTSW 1 75429118 missense probably damaging 1.00
R0800:Speg UTSW 1 75423489 missense probably damaging 1.00
R0815:Speg UTSW 1 75415392 missense probably damaging 1.00
R0835:Speg UTSW 1 75375674 missense probably benign 0.00
R0866:Speg UTSW 1 75417083 missense probably damaging 0.99
R0880:Speg UTSW 1 75405061 missense probably damaging 1.00
R1082:Speg UTSW 1 75415138 missense possibly damaging 0.94
R1140:Speg UTSW 1 75429095 missense probably damaging 1.00
R1252:Speg UTSW 1 75427095 missense probably damaging 1.00
R1301:Speg UTSW 1 75401501 missense probably damaging 1.00
R1348:Speg UTSW 1 75422872 missense probably damaging 0.99
R1388:Speg UTSW 1 75430460 missense probably damaging 0.99
R1465:Speg UTSW 1 75428484 splice site probably benign
R1505:Speg UTSW 1 75375542 missense probably benign 0.02
R1506:Speg UTSW 1 75417663 missense probably benign 0.03
R1543:Speg UTSW 1 75421951 missense probably damaging 1.00
R1567:Speg UTSW 1 75428047 missense probably benign
R1630:Speg UTSW 1 75422977 missense probably damaging 1.00
R1667:Speg UTSW 1 75410549 splice site probably benign
R1673:Speg UTSW 1 75411163 missense possibly damaging 0.60
R1718:Speg UTSW 1 75417863 missense probably benign 0.00
R1718:Speg UTSW 1 75421744 missense possibly damaging 0.87
R1719:Speg UTSW 1 75417863 missense probably benign 0.00
R1759:Speg UTSW 1 75401162 missense possibly damaging 0.95
R1861:Speg UTSW 1 75389005 missense probably damaging 1.00
R1874:Speg UTSW 1 75423906 missense probably benign
R1936:Speg UTSW 1 75431408 missense possibly damaging 0.93
R2192:Speg UTSW 1 75417727 missense probably damaging 1.00
R2204:Speg UTSW 1 75430477 missense probably benign 0.30
R2287:Speg UTSW 1 75430465 missense possibly damaging 0.76
R2696:Speg UTSW 1 75406926 missense probably benign 0.27
R2983:Speg UTSW 1 75384930 missense possibly damaging 0.83
R3110:Speg UTSW 1 75422682 nonsense probably null
R3112:Speg UTSW 1 75422682 nonsense probably null
R3154:Speg UTSW 1 75401542 missense probably damaging 1.00
R3720:Speg UTSW 1 75426782 missense probably damaging 1.00
R3983:Speg UTSW 1 75422547 missense probably benign 0.27
R4133:Speg UTSW 1 75427904 missense probably benign
R4522:Speg UTSW 1 75428330 missense probably damaging 1.00
R4564:Speg UTSW 1 75391834 missense probably damaging 1.00
R4577:Speg UTSW 1 75415395 missense probably damaging 1.00
R4858:Speg UTSW 1 75421735 missense probably damaging 1.00
R4953:Speg UTSW 1 75423864 missense possibly damaging 0.72
R4965:Speg UTSW 1 75427703 missense probably damaging 1.00
R4967:Speg UTSW 1 75387869 missense probably damaging 1.00
R5152:Speg UTSW 1 75428098 missense possibly damaging 0.92
R5156:Speg UTSW 1 75428087 missense probably damaging 0.99
R5371:Speg UTSW 1 75431393 missense possibly damaging 0.50
R5550:Speg UTSW 1 75429100 missense probably damaging 1.00
R5562:Speg UTSW 1 75427056 missense probably damaging 1.00
R5687:Speg UTSW 1 75419129 splice site probably null
R5985:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6004:Speg UTSW 1 75415603 nonsense probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6143:Speg UTSW 1 75414387 missense probably damaging 1.00
R6265:Speg UTSW 1 75406679 nonsense probably null
R6347:Speg UTSW 1 75426875 missense probably benign 0.00
R6453:Speg UTSW 1 75417972 missense probably benign 0.06
R6505:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6505:Speg UTSW 1 75429523 missense possibly damaging 0.93
R6531:Speg UTSW 1 75422757 missense probably benign 0.03
R6566:Speg UTSW 1 75388463 missense probably damaging 1.00
R6747:Speg UTSW 1 75410395 critical splice donor site probably null
R6819:Speg UTSW 1 75391812 missense possibly damaging 0.56
R6821:Speg UTSW 1 75417903 missense possibly damaging 0.83
R6919:Speg UTSW 1 75387908 nonsense probably null
R6981:Speg UTSW 1 75430913 missense probably damaging 1.00
R7002:Speg UTSW 1 75423268 missense probably damaging 0.98
R7082:Speg UTSW 1 75411447 missense probably damaging 0.96
R7140:Speg UTSW 1 75406770 critical splice donor site probably null
R7175:Speg UTSW 1 75422490 missense probably benign 0.01
R7178:Speg UTSW 1 75422383 missense possibly damaging 0.46
R7345:Speg UTSW 1 75384835 missense probably damaging 0.97
R7420:Speg UTSW 1 75430905 missense probably damaging 1.00
R7537:Speg UTSW 1 75401464 missense probably damaging 1.00
R7562:Speg UTSW 1 75431279 missense probably damaging 0.97
R7615:Speg UTSW 1 75429242 missense probably damaging 1.00
R7679:Speg UTSW 1 75406315 missense probably damaging 1.00
R7692:Speg UTSW 1 75401190 missense probably benign 0.04
R7696:Speg UTSW 1 75429161 missense probably damaging 1.00
R7719:Speg UTSW 1 75375825 missense probably damaging 1.00
R7794:Speg UTSW 1 75388870 missense probably benign 0.00
R7824:Speg UTSW 1 75384017 splice site probably null
R7834:Speg UTSW 1 75384927 missense probably damaging 1.00
R7892:Speg UTSW 1 75427166 missense probably damaging 1.00
R8015:Speg UTSW 1 75415421 splice site probably benign
R8068:Speg UTSW 1 75422250 missense probably damaging 1.00
R8085:Speg UTSW 1 75415353 missense probably damaging 1.00
R8130:Speg UTSW 1 75415596 missense probably damaging 1.00
R8132:Speg UTSW 1 75422995 missense probably damaging 1.00
R8239:Speg UTSW 1 75419033 missense probably damaging 1.00
R8287:Speg UTSW 1 75422236 missense probably benign 0.26
R8299:Speg UTSW 1 75387836 missense possibly damaging 0.95
R8441:Speg UTSW 1 75411332 missense possibly damaging 0.60
R8468:Speg UTSW 1 75431309 missense probably damaging 1.00
R8555:Speg UTSW 1 75402264 splice site probably null
R8781:Speg UTSW 1 75407021 missense probably damaging 1.00
R8784:Speg UTSW 1 75405149 critical splice donor site probably benign
R8848:Speg UTSW 1 75427438 critical splice donor site probably null
R8881:Speg UTSW 1 75401151 missense possibly damaging 0.67
R8898:Speg UTSW 1 75388873 missense probably damaging 1.00
R8935:Speg UTSW 1 75422606 missense probably benign 0.30
X0025:Speg UTSW 1 75422457 missense probably damaging 1.00
X0026:Speg UTSW 1 75423475 missense possibly damaging 0.88
Z1176:Speg UTSW 1 75406594 missense probably damaging 1.00
Z1177:Speg UTSW 1 75427683 missense probably damaging 1.00
Z1177:Speg UTSW 1 75428381 missense probably damaging 1.00
Z1177:Speg UTSW 1 75430455 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCTAAAGCCATCAGTGGCTCTTC -3'
(R):5'- ATGCCAAAGCATCAGGGGTGAC -3'

Sequencing Primer
(F):5'- CTAACATGAGGATAGGCTTTGGC -3'
(R):5'- GGTGACAGAGCATAGCTCC -3'
Posted On2014-04-13