Incidental Mutation 'R1531:Esrp1'
ID 166178
Institutional Source Beutler Lab
Gene Symbol Esrp1
Ensembl Gene ENSMUSG00000040728
Gene Name epithelial splicing regulatory protein 1
Synonyms 2210008M09Rik, Rbm35a
MMRRC Submission 039570-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.511) question?
Stock # R1531 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 11331933-11386783 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11379375 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 136 (F136L)
Ref Sequence ENSEMBL: ENSMUSP00000103949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043781] [ENSMUST00000108310] [ENSMUST00000108311] [ENSMUST00000108313] [ENSMUST00000155519]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043781
AA Change: F136L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037921
Gene: ENSMUSG00000040728
AA Change: F136L

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108310
AA Change: F136L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103946
Gene: ENSMUSG00000040728
AA Change: F136L

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108311
AA Change: F136L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103947
Gene: ENSMUSG00000040728
AA Change: F136L

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 556 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108313
AA Change: F136L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103949
Gene: ENSMUSG00000040728
AA Change: F136L

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000155519
AA Change: F122L

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119598
Gene: ENSMUSG00000040728
AA Change: F122L

DomainStartEndE-ValueType
RRM 212 284 2.6e-2 SMART
RRM 313 388 1.75e-5 SMART
low complexity region 406 420 N/A INTRINSIC
Blast:RRM 432 472 7e-20 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ESPR1 is an epithelial cell-type-specific splicing regulator (Warzecha et al., 2009 [PubMed 19285943]).[supplied by OMIM, Aug 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit hyperactivity and circling with no detectable hearing deficits. Mice homozygous for a null allele exhibit bilateral cleft lip and cleft palate, and die at P0. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T A 13: 59,648,448 (GRCm39) probably null Het
Aldh3b2 T G 19: 4,027,543 (GRCm39) F28C probably damaging Het
Apaf1 T C 10: 90,890,383 (GRCm39) N540S probably damaging Het
Apob T C 12: 8,047,880 (GRCm39) I953T possibly damaging Het
Arhgef1 A G 7: 24,624,423 (GRCm39) T816A probably damaging Het
Arid4a T A 12: 71,122,779 (GRCm39) F1053L probably benign Het
Atxn1l A C 8: 110,458,691 (GRCm39) F524V probably damaging Het
Cad T A 5: 31,233,563 (GRCm39) M1874K probably benign Het
Ccdc40 G A 11: 119,154,015 (GRCm39) V1096I probably benign Het
Ccdc93 A G 1: 121,408,551 (GRCm39) D358G probably benign Het
Cd96 T C 16: 45,938,169 (GRCm39) T99A probably benign Het
Cdc42ep3 A T 17: 79,642,473 (GRCm39) M149K probably benign Het
Cgas A G 9: 78,349,763 (GRCm39) Y200H probably damaging Het
Cog4 A G 8: 111,606,353 (GRCm39) E613G probably benign Het
Crebbp A T 16: 3,902,381 (GRCm39) I2286N probably benign Het
Csf1 T C 3: 107,655,654 (GRCm39) E459G possibly damaging Het
Csrp2 A T 10: 110,771,066 (GRCm39) Y57F probably benign Het
Ctdspl C T 9: 118,869,650 (GRCm39) P244L probably damaging Het
Cyp2c29 A G 19: 39,313,412 (GRCm39) R303G probably damaging Het
Cyp4a10 C A 4: 115,375,632 (GRCm39) Y38* probably null Het
Dmgdh T A 13: 93,880,919 (GRCm39) I783N probably damaging Het
Efcc1 G A 6: 87,708,148 (GRCm39) E92K probably benign Het
Eif2ak4 T A 2: 118,273,691 (GRCm39) L872H probably damaging Het
Elp2 T A 18: 24,764,461 (GRCm39) S603T probably benign Het
Eml2 T A 7: 18,930,179 (GRCm39) L300H probably damaging Het
Esp3 A G 17: 40,946,827 (GRCm39) K50R possibly damaging Het
Exoc1 T A 5: 76,707,011 (GRCm39) D497E probably damaging Het
Fat3 A G 9: 15,908,761 (GRCm39) S2414P probably damaging Het
Foxj3 C T 4: 119,477,398 (GRCm39) P369S unknown Het
Gkn2 G T 6: 87,352,921 (GRCm39) probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,649,766 (GRCm39) noncoding transcript Het
Gm21905 A T 5: 68,103,724 (GRCm39) probably benign Het
Grhl1 T A 12: 24,632,962 (GRCm39) probably null Het
Grk6 A G 13: 55,599,967 (GRCm39) Y221C probably damaging Het
Hcrtr1 T A 4: 130,024,720 (GRCm39) K389* probably null Het
Hk1 G A 10: 62,120,563 (GRCm39) R545C probably damaging Het
Hsp90b1 A T 10: 86,532,659 (GRCm39) I339N probably benign Het
Ikzf3 T C 11: 98,381,272 (GRCm39) R103G probably damaging Het
Itgad A C 7: 127,777,542 (GRCm39) I141L probably benign Het
Jmjd6 T A 11: 116,733,266 (GRCm39) Y137F probably benign Het
Kcna1 A G 6: 126,619,030 (GRCm39) V430A probably benign Het
Kel A G 6: 41,665,560 (GRCm39) V520A probably damaging Het
Klhl41 G A 2: 69,501,084 (GRCm39) V182I probably benign Het
Ldhb C A 6: 142,447,121 (GRCm39) M64I probably benign Het
Lrrc23 A G 6: 124,753,077 (GRCm39) S190P possibly damaging Het
Mboat2 T C 12: 25,009,029 (GRCm39) V445A probably benign Het
Mlycd G A 8: 120,128,258 (GRCm39) W188* probably null Het
Mpp3 C T 11: 101,899,475 (GRCm39) E349K probably benign Het
Mtres1 A G 10: 43,401,316 (GRCm39) V211A probably benign Het
Myh4 A G 11: 67,141,366 (GRCm39) M780V probably benign Het
Myh6 G A 14: 55,193,963 (GRCm39) R809C probably damaging Het
Mylip G A 13: 45,560,046 (GRCm39) V161M possibly damaging Het
Nrp1 G A 8: 129,152,450 (GRCm39) V220I probably null Het
Nup210 A T 6: 91,011,823 (GRCm39) N455K probably benign Het
Or14j10 A T 17: 37,935,243 (GRCm39) Y94* probably null Het
Or51f1d C A 7: 102,700,795 (GRCm39) Q97K probably benign Het
Pbld2 G T 10: 62,889,732 (GRCm39) probably null Het
Pclo C G 5: 14,571,917 (GRCm39) P434R probably damaging Het
Pdlim3 A G 8: 46,349,800 (GRCm39) K37E probably damaging Het
Prkdc T A 16: 15,589,970 (GRCm39) I2611N probably benign Het
Prr12 T C 7: 44,677,954 (GRCm39) D2019G unknown Het
Rab27a A G 9: 73,002,685 (GRCm39) T205A probably benign Het
Rcan3 A G 4: 135,152,595 (GRCm39) L42P probably damaging Het
Rchy1 T C 5: 92,103,474 (GRCm39) probably null Het
Sema6a T C 18: 47,382,066 (GRCm39) H827R probably damaging Het
Sertad4 A G 1: 192,533,258 (GRCm39) probably null Het
Smarcd1 T A 15: 99,605,264 (GRCm39) C282S probably damaging Het
Speg A G 1: 75,377,866 (GRCm39) T769A possibly damaging Het
Syne1 T A 10: 5,297,875 (GRCm39) K1141* probably null Het
Synpo2 T C 3: 122,911,315 (GRCm39) E110G probably benign Het
Tg T A 15: 66,722,351 (GRCm39) D333E probably benign Het
Tmem132c A G 5: 127,436,955 (GRCm39) Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 (GRCm39) V14E probably damaging Het
Tmem229b A G 12: 79,011,685 (GRCm39) L82P probably damaging Het
Togaram1 A G 12: 65,013,039 (GRCm39) T97A probably benign Het
Trappc9 G A 15: 72,565,397 (GRCm39) R965* probably null Het
Trio T C 15: 27,833,071 (GRCm39) I104V probably benign Het
Trp73 A G 4: 154,148,352 (GRCm39) F354S probably benign Het
Ttyh2 T C 11: 114,577,278 (GRCm39) L63P probably damaging Het
Ulk4 G C 9: 120,873,841 (GRCm39) P1197A probably damaging Het
Vmn1r176 T C 7: 23,534,536 (GRCm39) M206V possibly damaging Het
Vps8 T A 16: 21,285,226 (GRCm39) Y402* probably null Het
Zbtb41 A G 1: 139,350,931 (GRCm39) I15V probably benign Het
Zc3hav1 T C 6: 38,284,170 (GRCm39) I982V possibly damaging Het
Zmynd19 T A 2: 24,848,123 (GRCm39) N106K probably benign Het
Other mutations in Esrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Esrp1 APN 4 11,384,374 (GRCm39) missense possibly damaging 0.47
IGL02251:Esrp1 APN 4 11,361,202 (GRCm39) missense probably damaging 1.00
IGL02669:Esrp1 APN 4 11,386,324 (GRCm39) missense possibly damaging 0.61
Barley UTSW 4 11,365,205 (GRCm39) missense probably damaging 1.00
korn UTSW 4 11,357,519 (GRCm39) missense probably damaging 1.00
triaka UTSW 4 11,379,300 (GRCm39) missense probably benign 0.01
R1109:Esrp1 UTSW 4 11,365,205 (GRCm39) missense probably damaging 1.00
R2189:Esrp1 UTSW 4 11,357,603 (GRCm39) missense probably benign 0.04
R2255:Esrp1 UTSW 4 11,365,211 (GRCm39) missense probably damaging 0.99
R5919:Esrp1 UTSW 4 11,344,146 (GRCm39) missense probably damaging 0.96
R5924:Esrp1 UTSW 4 11,361,174 (GRCm39) missense probably damaging 1.00
R6042:Esrp1 UTSW 4 11,357,580 (GRCm39) missense possibly damaging 0.93
R6749:Esrp1 UTSW 4 11,357,519 (GRCm39) missense probably damaging 1.00
R6817:Esrp1 UTSW 4 11,357,552 (GRCm39) missense probably damaging 1.00
R7392:Esrp1 UTSW 4 11,338,809 (GRCm39) missense probably benign 0.00
R7607:Esrp1 UTSW 4 11,384,449 (GRCm39) missense probably damaging 0.99
R7985:Esrp1 UTSW 4 11,367,153 (GRCm39) missense probably benign 0.17
R8050:Esrp1 UTSW 4 11,338,767 (GRCm39) missense probably damaging 1.00
R9512:Esrp1 UTSW 4 11,365,449 (GRCm39) missense probably benign 0.44
Z1176:Esrp1 UTSW 4 11,385,765 (GRCm39) missense possibly damaging 0.64
Z1176:Esrp1 UTSW 4 11,384,396 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACTTGGCAGGAACACTCTGAC -3'
(R):5'- GCTTAATCGGAAGGCACAGTGACC -3'

Sequencing Primer
(F):5'- agggggatacctgtaagtctg -3'
(R):5'- GGCACAGTGACCATGTTACTC -3'
Posted On 2014-04-13