Incidental Mutation 'R1531:Foxj3'
ID 166181
Institutional Source Beutler Lab
Gene Symbol Foxj3
Ensembl Gene ENSMUSG00000032998
Gene Name forkhead box J3
Synonyms C330039G02Rik, Fhd6
MMRRC Submission 039570-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock # R1531 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 119537004-119629119 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 119620201 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 369 (P369S)
Ref Sequence ENSEMBL: ENSMUSP00000101917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044564] [ENSMUST00000106310]
AlphaFold Q8BUR3
Predicted Effect unknown
Transcript: ENSMUST00000044564
AA Change: P403S
SMART Domains Protein: ENSMUSP00000035746
Gene: ENSMUSG00000032998
AA Change: P403S

DomainStartEndE-ValueType
FH 76 164 6.03e-50 SMART
low complexity region 226 239 N/A INTRINSIC
low complexity region 263 274 N/A INTRINSIC
low complexity region 317 346 N/A INTRINSIC
low complexity region 372 434 N/A INTRINSIC
low complexity region 611 620 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000106310
AA Change: P369S
SMART Domains Protein: ENSMUSP00000101917
Gene: ENSMUSG00000032998
AA Change: P369S

DomainStartEndE-ValueType
FH 76 164 6.03e-50 SMART
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 283 312 N/A INTRINSIC
low complexity region 338 400 N/A INTRINSIC
low complexity region 577 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133097
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have an abnormal skeletal muscle fiber type ratio in males as well as defects in muscle regeneration following injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A G 10: 43,525,320 V211A probably benign Het
Agtpbp1 T A 13: 59,500,634 probably null Het
Aldh3b2 T G 19: 3,977,543 F28C probably damaging Het
Apaf1 T C 10: 91,054,521 N540S probably damaging Het
Apob T C 12: 7,997,880 I953T possibly damaging Het
Arhgef1 A G 7: 24,924,998 T816A probably damaging Het
Arid4a T A 12: 71,076,005 F1053L probably benign Het
Atxn1l A C 8: 109,732,059 F524V probably damaging Het
Cad T A 5: 31,076,219 M1874K probably benign Het
Ccdc40 G A 11: 119,263,189 V1096I probably benign Het
Ccdc93 A G 1: 121,480,822 D358G probably benign Het
Cd96 T C 16: 46,117,806 T99A probably benign Het
Cdc42ep3 A T 17: 79,335,044 M149K probably benign Het
Cog4 A G 8: 110,879,721 E613G probably benign Het
Crebbp A T 16: 4,084,517 I2286N probably benign Het
Csf1 T C 3: 107,748,338 E459G possibly damaging Het
Csrp2 A T 10: 110,935,205 Y57F probably benign Het
Ctdspl C T 9: 119,040,582 P244L probably damaging Het
Cyp2c29 A G 19: 39,324,968 R303G probably damaging Het
Cyp4a10 C A 4: 115,518,435 Y38* probably null Het
Dmgdh T A 13: 93,744,411 I783N probably damaging Het
Efcc1 G A 6: 87,731,166 E92K probably benign Het
Eif2ak4 T A 2: 118,443,210 L872H probably damaging Het
Elp2 T A 18: 24,631,404 S603T probably benign Het
Eml2 T A 7: 19,196,254 L300H probably damaging Het
Esp3 A G 17: 40,635,936 K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 F136L probably damaging Het
Exoc1 T A 5: 76,559,164 D497E probably damaging Het
Fat3 A G 9: 15,997,465 S2414P probably damaging Het
Gkn2 G T 6: 87,375,939 probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gm21905 A T 5: 67,946,381 probably benign Het
Grhl1 T A 12: 24,582,963 probably null Het
Grk6 A G 13: 55,452,154 Y221C probably damaging Het
Hcrtr1 T A 4: 130,130,927 K389* probably null Het
Hk1 G A 10: 62,284,784 R545C probably damaging Het
Hsp90b1 A T 10: 86,696,795 I339N probably benign Het
Ikzf3 T C 11: 98,490,446 R103G probably damaging Het
Itgad A C 7: 128,178,370 I141L probably benign Het
Jmjd6 T A 11: 116,842,440 Y137F probably benign Het
Kcna1 A G 6: 126,642,067 V430A probably benign Het
Kel A G 6: 41,688,626 V520A probably damaging Het
Klhl41 G A 2: 69,670,740 V182I probably benign Het
Ldhb C A 6: 142,501,395 M64I probably benign Het
Lrrc23 A G 6: 124,776,114 S190P possibly damaging Het
Mb21d1 A G 9: 78,442,481 Y200H probably damaging Het
Mboat2 T C 12: 24,959,030 V445A probably benign Het
Mlycd G A 8: 119,401,519 W188* probably null Het
Mpp3 C T 11: 102,008,649 E349K probably benign Het
Myh4 A G 11: 67,250,540 M780V probably benign Het
Myh6 G A 14: 54,956,506 R809C probably damaging Het
Mylip G A 13: 45,406,570 V161M possibly damaging Het
Nrp1 G A 8: 128,425,969 V220I probably null Het
Nup210 A T 6: 91,034,841 N455K probably benign Het
Olfr116 A T 17: 37,624,352 Y94* probably null Het
Olfr583 C A 7: 103,051,588 Q97K probably benign Het
Pbld2 G T 10: 63,053,953 probably null Het
Pclo C G 5: 14,521,903 P434R probably damaging Het
Pdlim3 A G 8: 45,896,763 K37E probably damaging Het
Prkdc T A 16: 15,772,106 I2611N probably benign Het
Prr12 T C 7: 45,028,530 D2019G unknown Het
Rab27a A G 9: 73,095,403 T205A probably benign Het
Rcan3 A G 4: 135,425,284 L42P probably damaging Het
Rchy1 T C 5: 91,955,615 probably null Het
Sema6a T C 18: 47,248,999 H827R probably damaging Het
Sertad4 A G 1: 192,850,950 probably null Het
Smarcd1 T A 15: 99,707,383 C282S probably damaging Het
Speg A G 1: 75,401,222 T769A possibly damaging Het
Syne1 T A 10: 5,347,875 K1141* probably null Het
Synpo2 T C 3: 123,117,666 E110G probably benign Het
Tg T A 15: 66,850,502 D333E probably benign Het
Tmem132c A G 5: 127,359,891 Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 V14E probably damaging Het
Tmem229b A G 12: 78,964,911 L82P probably damaging Het
Togaram1 A G 12: 64,966,265 T97A probably benign Het
Trappc9 G A 15: 72,693,548 R965* probably null Het
Trio T C 15: 27,832,985 I104V probably benign Het
Trp73 A G 4: 154,063,895 F354S probably benign Het
Ttyh2 T C 11: 114,686,452 L63P probably damaging Het
Ulk4 G C 9: 121,044,775 P1197A probably damaging Het
Vmn1r176 T C 7: 23,835,111 M206V possibly damaging Het
Vps8 T A 16: 21,466,476 Y402* probably null Het
Zbtb41 A G 1: 139,423,193 I15V probably benign Het
Zc3hav1 T C 6: 38,307,235 I982V possibly damaging Het
Zmynd19 T A 2: 24,958,111 N106K probably benign Het
Other mutations in Foxj3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Foxj3 APN 4 119610029 missense probably benign 0.03
IGL01452:Foxj3 APN 4 119621628 missense unknown
IGL02056:Foxj3 APN 4 119585757 missense probably damaging 1.00
IGL02455:Foxj3 APN 4 119620237 missense unknown
IGL02542:Foxj3 APN 4 119620343 missense unknown
IGL02625:Foxj3 APN 4 119624917 missense unknown
IGL03216:Foxj3 APN 4 119609983 intron probably benign
R0087:Foxj3 UTSW 4 119626400 missense unknown
R0488:Foxj3 UTSW 4 119619990 nonsense probably null
R0512:Foxj3 UTSW 4 119585836 splice site probably benign
R1799:Foxj3 UTSW 4 119619351 missense probably benign 0.06
R1883:Foxj3 UTSW 4 119610029 missense probably benign 0.20
R3690:Foxj3 UTSW 4 119616642 splice site probably benign
R3691:Foxj3 UTSW 4 119616642 splice site probably benign
R3838:Foxj3 UTSW 4 119616624 missense possibly damaging 0.49
R4065:Foxj3 UTSW 4 119610009 missense probably benign 0.09
R4295:Foxj3 UTSW 4 119626297 nonsense probably null
R4576:Foxj3 UTSW 4 119621663 missense unknown
R4750:Foxj3 UTSW 4 119616590 missense probably damaging 0.99
R4782:Foxj3 UTSW 4 119621660 missense unknown
R4799:Foxj3 UTSW 4 119621660 missense unknown
R5305:Foxj3 UTSW 4 119619958 missense possibly damaging 0.73
R5358:Foxj3 UTSW 4 119619399 missense probably damaging 1.00
R5362:Foxj3 UTSW 4 119620143 missense unknown
R5728:Foxj3 UTSW 4 119573762 missense probably damaging 1.00
R5732:Foxj3 UTSW 4 119585811 missense probably damaging 1.00
R6151:Foxj3 UTSW 4 119623271 missense unknown
R6352:Foxj3 UTSW 4 119585778 missense probably damaging 1.00
R6377:Foxj3 UTSW 4 119573748 splice site probably null
R7034:Foxj3 UTSW 4 119619300 missense probably damaging 0.97
R7672:Foxj3 UTSW 4 119620232 missense unknown
R7912:Foxj3 UTSW 4 119620055 missense possibly damaging 0.63
R8215:Foxj3 UTSW 4 119621611 missense unknown
R9190:Foxj3 UTSW 4 119620341 nonsense probably null
R9624:Foxj3 UTSW 4 119626392 missense unknown
R9762:Foxj3 UTSW 4 119626343 missense unknown
Predicted Primers PCR Primer
(F):5'- ACACTCTCCTAGCAGTACAGTGACC -3'
(R):5'- ATGAAGGGCAGACCTAATTCACAGC -3'

Sequencing Primer
(F):5'- GCAGTACAGTGACCTCTCACC -3'
(R):5'- GGCAGACCTAATTCACAGCTATTC -3'
Posted On 2014-04-13