Incidental Mutation 'R1531:Cad'
ID 166187
Institutional Source Beutler Lab
Gene Symbol Cad
Ensembl Gene ENSMUSG00000013629
Gene Name carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms
MMRRC Submission 039570-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R1531 (G1)
Quality Score 224
Status Not validated
Chromosome 5
Chromosomal Location 31054780-31078479 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31076219 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1874 (M1874K)
Ref Sequence ENSEMBL: ENSMUSP00000144307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013773] [ENSMUST00000200953] [ENSMUST00000201182] [ENSMUST00000202795] [ENSMUST00000202973]
AlphaFold B2RQC6
Predicted Effect probably benign
Transcript: ENSMUST00000013773
AA Change: M1937K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629
AA Change: M1937K

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.7e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.2e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.8e-85 PFAM
Pfam:ATP-grasp 522 690 1.5e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.2e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.8e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.4e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1924 2065 1.9e-44 PFAM
Pfam:OTCace 2071 2221 7.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200917
Predicted Effect probably benign
Transcript: ENSMUST00000200953
AA Change: M1874K

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629
AA Change: M1874K

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:CPSase_L_D2 514 616 1.5e-34 PFAM
Pfam:Dala_Dala_lig_C 527 625 2.4e-7 PFAM
Pfam:CPSase_L_D2 614 655 4.9e-15 PFAM
CPSase_L_D3 735 858 9.7e-59 SMART
Pfam:ATP-grasp_4 981 1160 1.7e-23 PFAM
Pfam:CPSase_L_D2 984 1187 3e-28 PFAM
Pfam:Dala_Dala_lig_C 991 1179 2.3e-7 PFAM
Pfam:ATP-grasp 992 1159 2.1e-12 PFAM
MGS 1264 1365 1.35e-7 SMART
Pfam:Amidohydro_1 1399 1667 7.1e-12 PFAM
low complexity region 1757 1776 N/A INTRINSIC
low complexity region 1801 1817 N/A INTRINSIC
Pfam:OTCace_N 1861 2002 1.8e-44 PFAM
Pfam:OTCace 2008 2158 7.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201182
AA Change: M1937K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629
AA Change: M1937K

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.1e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.7e-85 PFAM
Pfam:ATP-grasp 522 690 1.4e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.1e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.7e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.1e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1949 1994 1.4e-11 PFAM
Pfam:OTCace 2000 2150 7.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202391
Predicted Effect probably benign
Transcript: ENSMUST00000202795
AA Change: M1937K

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629
AA Change: M1937K

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 1.9e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 5.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 1.2e-85 PFAM
Pfam:ATP-grasp 522 690 7.3e-10 PFAM
Pfam:Dala_Dala_lig_C 527 687 1.3e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 8.9e-24 PFAM
Pfam:CPSase_L_D2 1047 1250 2.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 1.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 1.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 2.5e-11 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1970 2004 4.6e-11 PFAM
Pfam:OTCace 2010 2160 9.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202827
Predicted Effect probably benign
Transcript: ENSMUST00000202973
SMART Domains Protein: ENSMUSP00000144679
Gene: ENSMUSG00000013629

DomainStartEndE-ValueType
SCOP:d1gkra1 1 84 4e-28 SMART
PDB:4C6N|A 1 119 4e-58 PDB
low complexity region 156 170 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A G 10: 43,525,320 V211A probably benign Het
Agtpbp1 T A 13: 59,500,634 probably null Het
Aldh3b2 T G 19: 3,977,543 F28C probably damaging Het
Apaf1 T C 10: 91,054,521 N540S probably damaging Het
Apob T C 12: 7,997,880 I953T possibly damaging Het
Arhgef1 A G 7: 24,924,998 T816A probably damaging Het
Arid4a T A 12: 71,076,005 F1053L probably benign Het
Atxn1l A C 8: 109,732,059 F524V probably damaging Het
Ccdc40 G A 11: 119,263,189 V1096I probably benign Het
Ccdc93 A G 1: 121,480,822 D358G probably benign Het
Cd96 T C 16: 46,117,806 T99A probably benign Het
Cdc42ep3 A T 17: 79,335,044 M149K probably benign Het
Cog4 A G 8: 110,879,721 E613G probably benign Het
Crebbp A T 16: 4,084,517 I2286N probably benign Het
Csf1 T C 3: 107,748,338 E459G possibly damaging Het
Csrp2 A T 10: 110,935,205 Y57F probably benign Het
Ctdspl C T 9: 119,040,582 P244L probably damaging Het
Cyp2c29 A G 19: 39,324,968 R303G probably damaging Het
Cyp4a10 C A 4: 115,518,435 Y38* probably null Het
Dmgdh T A 13: 93,744,411 I783N probably damaging Het
Efcc1 G A 6: 87,731,166 E92K probably benign Het
Eif2ak4 T A 2: 118,443,210 L872H probably damaging Het
Elp2 T A 18: 24,631,404 S603T probably benign Het
Eml2 T A 7: 19,196,254 L300H probably damaging Het
Esp3 A G 17: 40,635,936 K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 F136L probably damaging Het
Exoc1 T A 5: 76,559,164 D497E probably damaging Het
Fat3 A G 9: 15,997,465 S2414P probably damaging Het
Foxj3 C T 4: 119,620,201 P369S unknown Het
Gkn2 G T 6: 87,375,939 probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gm21905 A T 5: 67,946,381 probably benign Het
Grhl1 T A 12: 24,582,963 probably null Het
Grk6 A G 13: 55,452,154 Y221C probably damaging Het
Hcrtr1 T A 4: 130,130,927 K389* probably null Het
Hk1 G A 10: 62,284,784 R545C probably damaging Het
Hsp90b1 A T 10: 86,696,795 I339N probably benign Het
Ikzf3 T C 11: 98,490,446 R103G probably damaging Het
Itgad A C 7: 128,178,370 I141L probably benign Het
Jmjd6 T A 11: 116,842,440 Y137F probably benign Het
Kcna1 A G 6: 126,642,067 V430A probably benign Het
Kel A G 6: 41,688,626 V520A probably damaging Het
Klhl41 G A 2: 69,670,740 V182I probably benign Het
Ldhb C A 6: 142,501,395 M64I probably benign Het
Lrrc23 A G 6: 124,776,114 S190P possibly damaging Het
Mb21d1 A G 9: 78,442,481 Y200H probably damaging Het
Mboat2 T C 12: 24,959,030 V445A probably benign Het
Mlycd G A 8: 119,401,519 W188* probably null Het
Mpp3 C T 11: 102,008,649 E349K probably benign Het
Myh4 A G 11: 67,250,540 M780V probably benign Het
Myh6 G A 14: 54,956,506 R809C probably damaging Het
Mylip G A 13: 45,406,570 V161M possibly damaging Het
Nrp1 G A 8: 128,425,969 V220I probably null Het
Nup210 A T 6: 91,034,841 N455K probably benign Het
Olfr116 A T 17: 37,624,352 Y94* probably null Het
Olfr583 C A 7: 103,051,588 Q97K probably benign Het
Pbld2 G T 10: 63,053,953 probably null Het
Pclo C G 5: 14,521,903 P434R probably damaging Het
Pdlim3 A G 8: 45,896,763 K37E probably damaging Het
Prkdc T A 16: 15,772,106 I2611N probably benign Het
Prr12 T C 7: 45,028,530 D2019G unknown Het
Rab27a A G 9: 73,095,403 T205A probably benign Het
Rcan3 A G 4: 135,425,284 L42P probably damaging Het
Rchy1 T C 5: 91,955,615 probably null Het
Sema6a T C 18: 47,248,999 H827R probably damaging Het
Sertad4 A G 1: 192,850,950 probably null Het
Smarcd1 T A 15: 99,707,383 C282S probably damaging Het
Speg A G 1: 75,401,222 T769A possibly damaging Het
Syne1 T A 10: 5,347,875 K1141* probably null Het
Synpo2 T C 3: 123,117,666 E110G probably benign Het
Tg T A 15: 66,850,502 D333E probably benign Het
Tmem132c A G 5: 127,359,891 Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 V14E probably damaging Het
Tmem229b A G 12: 78,964,911 L82P probably damaging Het
Togaram1 A G 12: 64,966,265 T97A probably benign Het
Trappc9 G A 15: 72,693,548 R965* probably null Het
Trio T C 15: 27,832,985 I104V probably benign Het
Trp73 A G 4: 154,063,895 F354S probably benign Het
Ttyh2 T C 11: 114,686,452 L63P probably damaging Het
Ulk4 G C 9: 121,044,775 P1197A probably damaging Het
Vmn1r176 T C 7: 23,835,111 M206V possibly damaging Het
Vps8 T A 16: 21,466,476 Y402* probably null Het
Zbtb41 A G 1: 139,423,193 I15V probably benign Het
Zc3hav1 T C 6: 38,307,235 I982V possibly damaging Het
Zmynd19 T A 2: 24,958,111 N106K probably benign Het
Other mutations in Cad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Cad APN 5 31061484 missense probably damaging 1.00
IGL00908:Cad APN 5 31059054 missense possibly damaging 0.93
IGL01068:Cad APN 5 31061770 splice site probably benign
IGL01638:Cad APN 5 31067614 missense probably damaging 1.00
IGL02483:Cad APN 5 31060826 critical splice acceptor site probably null
IGL02499:Cad APN 5 31069604 missense probably damaging 1.00
IGL02691:Cad APN 5 31055294 missense probably damaging 1.00
IGL03002:Cad APN 5 31054986 missense probably benign 0.00
PIT4696001:Cad UTSW 5 31072094 missense probably damaging 0.99
R0212:Cad UTSW 5 31078110 missense probably damaging 1.00
R0317:Cad UTSW 5 31072321 missense probably benign 0.01
R0335:Cad UTSW 5 31073985 unclassified probably benign
R0401:Cad UTSW 5 31073986 unclassified probably benign
R0445:Cad UTSW 5 31072709 missense probably benign 0.08
R0494:Cad UTSW 5 31077512 unclassified probably benign
R0532:Cad UTSW 5 31062187 splice site probably benign
R0539:Cad UTSW 5 31075457 splice site probably benign
R0578:Cad UTSW 5 31058776 missense probably benign 0.01
R0590:Cad UTSW 5 31062231 missense probably damaging 1.00
R0638:Cad UTSW 5 31077688 missense probably damaging 0.98
R0831:Cad UTSW 5 31067600 missense probably damaging 1.00
R1329:Cad UTSW 5 31059582 missense probably damaging 1.00
R1513:Cad UTSW 5 31068762 missense probably damaging 1.00
R1763:Cad UTSW 5 31060951 missense probably damaging 1.00
R1785:Cad UTSW 5 31058072 missense probably damaging 1.00
R1786:Cad UTSW 5 31058072 missense probably damaging 1.00
R2131:Cad UTSW 5 31058072 missense probably damaging 1.00
R2165:Cad UTSW 5 31062220 missense probably damaging 1.00
R3103:Cad UTSW 5 31061674 missense possibly damaging 0.95
R3113:Cad UTSW 5 31074137 missense possibly damaging 0.50
R3762:Cad UTSW 5 31075546 splice site probably null
R3847:Cad UTSW 5 31061650 missense probably damaging 1.00
R3898:Cad UTSW 5 31074022 missense probably benign 0.06
R3943:Cad UTSW 5 31072385 critical splice donor site probably null
R4213:Cad UTSW 5 31072344 missense probably benign 0.01
R4458:Cad UTSW 5 31061226 missense probably damaging 1.00
R4562:Cad UTSW 5 31058133 missense possibly damaging 0.82
R4629:Cad UTSW 5 31070295 missense probably damaging 1.00
R4717:Cad UTSW 5 31066686 critical splice acceptor site probably null
R4811:Cad UTSW 5 31074690 missense probably benign 0.02
R5044:Cad UTSW 5 31055021 missense probably benign 0.00
R5630:Cad UTSW 5 31060573 missense probably damaging 1.00
R5660:Cad UTSW 5 31076847 missense probably damaging 1.00
R6008:Cad UTSW 5 31069112 missense probably damaging 1.00
R6029:Cad UTSW 5 31054983 missense possibly damaging 0.65
R6073:Cad UTSW 5 31062562 missense possibly damaging 0.84
R6240:Cad UTSW 5 31072978 missense probably benign 0.00
R6260:Cad UTSW 5 31066800 missense probably null
R7145:Cad UTSW 5 31067612 missense possibly damaging 0.89
R7303:Cad UTSW 5 31060213 critical splice donor site probably null
R7352:Cad UTSW 5 31058078 missense probably damaging 1.00
R7382:Cad UTSW 5 31075829 missense probably benign
R7387:Cad UTSW 5 31061940 missense probably damaging 1.00
R7455:Cad UTSW 5 31074162 missense probably damaging 0.99
R7596:Cad UTSW 5 31069048 missense probably benign
R7627:Cad UTSW 5 31060164 missense probably damaging 1.00
R7898:Cad UTSW 5 31061485 missense probably damaging 1.00
R8022:Cad UTSW 5 31068806 missense probably damaging 1.00
R8115:Cad UTSW 5 31060927 missense possibly damaging 0.82
R8511:Cad UTSW 5 31075821 missense probably benign 0.00
R8523:Cad UTSW 5 31058106 missense probably damaging 0.98
R8690:Cad UTSW 5 31075156 missense possibly damaging 0.58
R8697:Cad UTSW 5 31074601 missense probably benign 0.06
R8698:Cad UTSW 5 31077475 missense probably benign
R8699:Cad UTSW 5 31076261 missense possibly damaging 0.80
R8803:Cad UTSW 5 31069564 missense probably damaging 1.00
R9262:Cad UTSW 5 31067665 missense probably null
R9272:Cad UTSW 5 31061232 missense possibly damaging 0.91
R9287:Cad UTSW 5 31072656 missense possibly damaging 0.67
R9314:Cad UTSW 5 31077644 missense probably damaging 1.00
R9609:Cad UTSW 5 31070674 critical splice donor site probably null
R9665:Cad UTSW 5 31072359 missense probably benign 0.28
RF001:Cad UTSW 5 31060212 critical splice donor site probably benign
RF012:Cad UTSW 5 31060212 critical splice donor site probably benign
X0021:Cad UTSW 5 31068131 missense probably null 1.00
X0022:Cad UTSW 5 31072317 missense probably damaging 0.99
Z1177:Cad UTSW 5 31068421 missense probably damaging 1.00
Z1177:Cad UTSW 5 31075128 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CGCACTGATGCATATTTACCTGGGG -3'
(R):5'- ACTACCGTGACTCAGAGCTAAAGCC -3'

Sequencing Primer
(F):5'- GCCTCTGTAGTCTGATCCAAGTAG -3'
(R):5'- TTGCAAATGTCAACGGCTGC -3'
Posted On 2014-04-13