Incidental Mutation 'R1531:Zc3hav1'
ID 166193
Institutional Source Beutler Lab
Gene Symbol Zc3hav1
Ensembl Gene ENSMUSG00000029826
Gene Name zinc finger CCCH type, antiviral 1
Synonyms 9830115L13Rik, ZAP, 1200014N16Rik, 2900058M19Rik, 9130009D18Rik
MMRRC Submission 039570-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R1531 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 38282221-38331538 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38284170 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 982 (I982V)
Ref Sequence ENSEMBL: ENSMUSP00000110550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114900] [ENSMUST00000143702]
AlphaFold Q3UPF5
Predicted Effect possibly damaging
Transcript: ENSMUST00000114900
AA Change: I982V

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110550
Gene: ENSMUSG00000029826
AA Change: I982V

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.94e-5 PROSPERO
internal_repeat_1 166 208 1.94e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 2.8e-15 PFAM
Pfam:PARP 817 986 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143702
SMART Domains Protein: ENSMUSP00000144312
Gene: ENSMUSG00000029826

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.8e-5 PROSPERO
internal_repeat_1 166 208 1.8e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 1e-15 PFAM
Pfam:PARP 817 922 1.9e-12 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CCCH-type zinc finger protein that is thought to prevent infection by retroviruses. Studies of the rat homolog indicate that the protein may primarily function to inhibit viral gene expression and induce an innate immunity to viral infection. Alternative splicing occurs at this locus and two variants, each encoding distinct isoforms, are described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced murine leukemia virus replication efficiency in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T A 13: 59,648,448 (GRCm39) probably null Het
Aldh3b2 T G 19: 4,027,543 (GRCm39) F28C probably damaging Het
Apaf1 T C 10: 90,890,383 (GRCm39) N540S probably damaging Het
Apob T C 12: 8,047,880 (GRCm39) I953T possibly damaging Het
Arhgef1 A G 7: 24,624,423 (GRCm39) T816A probably damaging Het
Arid4a T A 12: 71,122,779 (GRCm39) F1053L probably benign Het
Atxn1l A C 8: 110,458,691 (GRCm39) F524V probably damaging Het
Cad T A 5: 31,233,563 (GRCm39) M1874K probably benign Het
Ccdc40 G A 11: 119,154,015 (GRCm39) V1096I probably benign Het
Ccdc93 A G 1: 121,408,551 (GRCm39) D358G probably benign Het
Cd96 T C 16: 45,938,169 (GRCm39) T99A probably benign Het
Cdc42ep3 A T 17: 79,642,473 (GRCm39) M149K probably benign Het
Cgas A G 9: 78,349,763 (GRCm39) Y200H probably damaging Het
Cog4 A G 8: 111,606,353 (GRCm39) E613G probably benign Het
Crebbp A T 16: 3,902,381 (GRCm39) I2286N probably benign Het
Csf1 T C 3: 107,655,654 (GRCm39) E459G possibly damaging Het
Csrp2 A T 10: 110,771,066 (GRCm39) Y57F probably benign Het
Ctdspl C T 9: 118,869,650 (GRCm39) P244L probably damaging Het
Cyp2c29 A G 19: 39,313,412 (GRCm39) R303G probably damaging Het
Cyp4a10 C A 4: 115,375,632 (GRCm39) Y38* probably null Het
Dmgdh T A 13: 93,880,919 (GRCm39) I783N probably damaging Het
Efcc1 G A 6: 87,708,148 (GRCm39) E92K probably benign Het
Eif2ak4 T A 2: 118,273,691 (GRCm39) L872H probably damaging Het
Elp2 T A 18: 24,764,461 (GRCm39) S603T probably benign Het
Eml2 T A 7: 18,930,179 (GRCm39) L300H probably damaging Het
Esp3 A G 17: 40,946,827 (GRCm39) K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 (GRCm39) F136L probably damaging Het
Exoc1 T A 5: 76,707,011 (GRCm39) D497E probably damaging Het
Fat3 A G 9: 15,908,761 (GRCm39) S2414P probably damaging Het
Foxj3 C T 4: 119,477,398 (GRCm39) P369S unknown Het
Gkn2 G T 6: 87,352,921 (GRCm39) probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,649,766 (GRCm39) noncoding transcript Het
Gm21905 A T 5: 68,103,724 (GRCm39) probably benign Het
Grhl1 T A 12: 24,632,962 (GRCm39) probably null Het
Grk6 A G 13: 55,599,967 (GRCm39) Y221C probably damaging Het
Hcrtr1 T A 4: 130,024,720 (GRCm39) K389* probably null Het
Hk1 G A 10: 62,120,563 (GRCm39) R545C probably damaging Het
Hsp90b1 A T 10: 86,532,659 (GRCm39) I339N probably benign Het
Ikzf3 T C 11: 98,381,272 (GRCm39) R103G probably damaging Het
Itgad A C 7: 127,777,542 (GRCm39) I141L probably benign Het
Jmjd6 T A 11: 116,733,266 (GRCm39) Y137F probably benign Het
Kcna1 A G 6: 126,619,030 (GRCm39) V430A probably benign Het
Kel A G 6: 41,665,560 (GRCm39) V520A probably damaging Het
Klhl41 G A 2: 69,501,084 (GRCm39) V182I probably benign Het
Ldhb C A 6: 142,447,121 (GRCm39) M64I probably benign Het
Lrrc23 A G 6: 124,753,077 (GRCm39) S190P possibly damaging Het
Mboat2 T C 12: 25,009,029 (GRCm39) V445A probably benign Het
Mlycd G A 8: 120,128,258 (GRCm39) W188* probably null Het
Mpp3 C T 11: 101,899,475 (GRCm39) E349K probably benign Het
Mtres1 A G 10: 43,401,316 (GRCm39) V211A probably benign Het
Myh4 A G 11: 67,141,366 (GRCm39) M780V probably benign Het
Myh6 G A 14: 55,193,963 (GRCm39) R809C probably damaging Het
Mylip G A 13: 45,560,046 (GRCm39) V161M possibly damaging Het
Nrp1 G A 8: 129,152,450 (GRCm39) V220I probably null Het
Nup210 A T 6: 91,011,823 (GRCm39) N455K probably benign Het
Or14j10 A T 17: 37,935,243 (GRCm39) Y94* probably null Het
Or51f1d C A 7: 102,700,795 (GRCm39) Q97K probably benign Het
Pbld2 G T 10: 62,889,732 (GRCm39) probably null Het
Pclo C G 5: 14,571,917 (GRCm39) P434R probably damaging Het
Pdlim3 A G 8: 46,349,800 (GRCm39) K37E probably damaging Het
Prkdc T A 16: 15,589,970 (GRCm39) I2611N probably benign Het
Prr12 T C 7: 44,677,954 (GRCm39) D2019G unknown Het
Rab27a A G 9: 73,002,685 (GRCm39) T205A probably benign Het
Rcan3 A G 4: 135,152,595 (GRCm39) L42P probably damaging Het
Rchy1 T C 5: 92,103,474 (GRCm39) probably null Het
Sema6a T C 18: 47,382,066 (GRCm39) H827R probably damaging Het
Sertad4 A G 1: 192,533,258 (GRCm39) probably null Het
Smarcd1 T A 15: 99,605,264 (GRCm39) C282S probably damaging Het
Speg A G 1: 75,377,866 (GRCm39) T769A possibly damaging Het
Syne1 T A 10: 5,297,875 (GRCm39) K1141* probably null Het
Synpo2 T C 3: 122,911,315 (GRCm39) E110G probably benign Het
Tg T A 15: 66,722,351 (GRCm39) D333E probably benign Het
Tmem132c A G 5: 127,436,955 (GRCm39) Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 (GRCm39) V14E probably damaging Het
Tmem229b A G 12: 79,011,685 (GRCm39) L82P probably damaging Het
Togaram1 A G 12: 65,013,039 (GRCm39) T97A probably benign Het
Trappc9 G A 15: 72,565,397 (GRCm39) R965* probably null Het
Trio T C 15: 27,833,071 (GRCm39) I104V probably benign Het
Trp73 A G 4: 154,148,352 (GRCm39) F354S probably benign Het
Ttyh2 T C 11: 114,577,278 (GRCm39) L63P probably damaging Het
Ulk4 G C 9: 120,873,841 (GRCm39) P1197A probably damaging Het
Vmn1r176 T C 7: 23,534,536 (GRCm39) M206V possibly damaging Het
Vps8 T A 16: 21,285,226 (GRCm39) Y402* probably null Het
Zbtb41 A G 1: 139,350,931 (GRCm39) I15V probably benign Het
Zmynd19 T A 2: 24,848,123 (GRCm39) N106K probably benign Het
Other mutations in Zc3hav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Zc3hav1 APN 6 38,296,768 (GRCm39) splice site probably null
IGL02225:Zc3hav1 APN 6 38,317,276 (GRCm39) missense probably damaging 1.00
IGL02266:Zc3hav1 APN 6 38,309,103 (GRCm39) missense probably benign 0.01
IGL02458:Zc3hav1 APN 6 38,317,264 (GRCm39) missense probably damaging 1.00
IGL02626:Zc3hav1 APN 6 38,309,926 (GRCm39) missense probably damaging 0.96
IGL02725:Zc3hav1 APN 6 38,309,127 (GRCm39) missense probably damaging 0.98
IGL02958:Zc3hav1 APN 6 38,309,919 (GRCm39) missense probably damaging 1.00
IGL03104:Zc3hav1 APN 6 38,317,278 (GRCm39) missense probably damaging 1.00
IGL03137:Zc3hav1 APN 6 38,309,329 (GRCm39) missense probably benign
IGL03238:Zc3hav1 APN 6 38,309,685 (GRCm39) missense probably damaging 0.99
IGL03380:Zc3hav1 APN 6 38,313,493 (GRCm39) missense probably damaging 1.00
IGL03055:Zc3hav1 UTSW 6 38,293,251 (GRCm39) splice site probably null
P0038:Zc3hav1 UTSW 6 38,309,469 (GRCm39) missense probably damaging 0.98
R0006:Zc3hav1 UTSW 6 38,296,637 (GRCm39) critical splice donor site probably null
R0207:Zc3hav1 UTSW 6 38,288,109 (GRCm39) missense probably benign 0.00
R0255:Zc3hav1 UTSW 6 38,313,485 (GRCm39) missense probably damaging 1.00
R0452:Zc3hav1 UTSW 6 38,284,372 (GRCm39) missense probably benign 0.01
R0505:Zc3hav1 UTSW 6 38,309,599 (GRCm39) missense probably damaging 1.00
R0865:Zc3hav1 UTSW 6 38,330,837 (GRCm39) splice site probably benign
R1281:Zc3hav1 UTSW 6 38,330,872 (GRCm39) missense probably damaging 1.00
R1873:Zc3hav1 UTSW 6 38,309,692 (GRCm39) missense possibly damaging 0.50
R1991:Zc3hav1 UTSW 6 38,313,452 (GRCm39) missense probably damaging 1.00
R2149:Zc3hav1 UTSW 6 38,313,472 (GRCm39) missense probably damaging 1.00
R2184:Zc3hav1 UTSW 6 38,284,343 (GRCm39) missense probably damaging 0.99
R2365:Zc3hav1 UTSW 6 38,317,168 (GRCm39) missense probably damaging 1.00
R2924:Zc3hav1 UTSW 6 38,331,045 (GRCm39) missense probably damaging 0.97
R3237:Zc3hav1 UTSW 6 38,296,650 (GRCm39) missense probably damaging 1.00
R3710:Zc3hav1 UTSW 6 38,309,097 (GRCm39) missense probably benign 0.35
R5683:Zc3hav1 UTSW 6 38,284,172 (GRCm39) missense probably damaging 1.00
R5684:Zc3hav1 UTSW 6 38,288,214 (GRCm39) missense probably benign 0.01
R5905:Zc3hav1 UTSW 6 38,284,275 (GRCm39) missense probably benign 0.03
R5959:Zc3hav1 UTSW 6 38,284,379 (GRCm39) missense probably benign 0.01
R6028:Zc3hav1 UTSW 6 38,284,275 (GRCm39) missense probably benign 0.03
R6261:Zc3hav1 UTSW 6 38,309,935 (GRCm39) missense probably benign 0.24
R6465:Zc3hav1 UTSW 6 38,308,784 (GRCm39) missense possibly damaging 0.85
R6682:Zc3hav1 UTSW 6 38,302,130 (GRCm39) missense probably benign 0.02
R6831:Zc3hav1 UTSW 6 38,309,103 (GRCm39) missense probably benign 0.01
R7082:Zc3hav1 UTSW 6 38,309,328 (GRCm39) nonsense probably null
R7196:Zc3hav1 UTSW 6 38,306,207 (GRCm39) missense probably benign
R7248:Zc3hav1 UTSW 6 38,330,911 (GRCm39) missense probably benign 0.04
R7319:Zc3hav1 UTSW 6 38,309,209 (GRCm39) missense probably benign
R7506:Zc3hav1 UTSW 6 38,309,875 (GRCm39) nonsense probably null
R7593:Zc3hav1 UTSW 6 38,306,121 (GRCm39) missense probably benign 0.01
R7788:Zc3hav1 UTSW 6 38,309,691 (GRCm39) missense probably benign 0.02
R7885:Zc3hav1 UTSW 6 38,313,598 (GRCm39) missense possibly damaging 0.82
R7892:Zc3hav1 UTSW 6 38,306,156 (GRCm39) missense probably benign 0.25
R8109:Zc3hav1 UTSW 6 38,306,114 (GRCm39) missense probably damaging 1.00
R8769:Zc3hav1 UTSW 6 38,313,416 (GRCm39) missense possibly damaging 0.81
R8880:Zc3hav1 UTSW 6 38,288,212 (GRCm39) missense probably benign
R9002:Zc3hav1 UTSW 6 38,302,176 (GRCm39) missense possibly damaging 0.94
R9527:Zc3hav1 UTSW 6 38,330,913 (GRCm39) missense probably damaging 1.00
R9558:Zc3hav1 UTSW 6 38,331,042 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATACTGGTTCACGGTAAGCGGAGG -3'
(R):5'- CAGAGGCACTGTCATGTTCGTAGC -3'

Sequencing Primer
(F):5'- CTAGACGCGAATTGCACTTTG -3'
(R):5'- ATGTTCGTAGCCCGAGTCC -3'
Posted On 2014-04-13