Mutagenetix > Incidental Mutation

Incidental Mutation 'R1531:Kel'

166194

Institutional Source

Beutler Lab

Gene Symbol

Kel

Ensembl Gene

ENSMUSG00000029866

Gene Name

Kell blood group

Synonyms

CD238

MMRRC Submission

039570-MU

Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R1531 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41686330-41704339 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41688626 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 520 (V520A)

Ref Sequence

ENSEMBL: ENSMUSP00000031899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031899] [ENSMUST00000031900] [ENSMUST00000194597]

AlphaFold

Q9EQF2

Predicted Effect

probably damaging
Transcript: ENSMUST00000031899
AA Change: V520A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: V520A

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
Pfam:Peptidase_M13_N	81	463	1.5e-68	PFAM
Pfam:Peptidase_M13	521	712	2.1e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000031900

SMART Domains

Protein: ENSMUSP00000031900
Gene: ENSMUSG00000029867

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:DUF4717	37	107	7.8e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141502

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153760

Predicted Effect

unknown
Transcript: ENSMUST00000192118
AA Change: V202A

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192406

Predicted Effect

probably benign
Transcript: ENSMUST00000194597

SMART Domains

Protein: ENSMUSP00000142058
Gene: ENSMUSG00000029866

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M13	16	68	3.6e-10	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	A	G	10: 43,525,320	V211A	probably benign	Het
Agtpbp1	T	A	13: 59,500,634		probably null	Het
Aldh3b2	T	G	19: 3,977,543	F28C	probably damaging	Het
Apaf1	T	C	10: 91,054,521	N540S	probably damaging	Het
Apob	T	C	12: 7,997,880	I953T	possibly damaging	Het
Arhgef1	A	G	7: 24,924,998	T816A	probably damaging	Het
Arid4a	T	A	12: 71,076,005	F1053L	probably benign	Het
Atxn1l	A	C	8: 109,732,059	F524V	probably damaging	Het
Cad	T	A	5: 31,076,219	M1874K	probably benign	Het
Ccdc40	G	A	11: 119,263,189	V1096I	probably benign	Het
Ccdc93	A	G	1: 121,480,822	D358G	probably benign	Het
Cd96	T	C	16: 46,117,806	T99A	probably benign	Het
Cdc42ep3	A	T	17: 79,335,044	M149K	probably benign	Het
Cog4	A	G	8: 110,879,721	E613G	probably benign	Het
Crebbp	A	T	16: 4,084,517	I2286N	probably benign	Het
Csf1	T	C	3: 107,748,338	E459G	possibly damaging	Het
Csrp2	A	T	10: 110,935,205	Y57F	probably benign	Het
Ctdspl	C	T	9: 119,040,582	P244L	probably damaging	Het
Cyp2c29	A	G	19: 39,324,968	R303G	probably damaging	Het
Cyp4a10	C	A	4: 115,518,435	Y38*	probably null	Het
Dmgdh	T	A	13: 93,744,411	I783N	probably damaging	Het
Efcc1	G	A	6: 87,731,166	E92K	probably benign	Het
Eif2ak4	T	A	2: 118,443,210	L872H	probably damaging	Het
Elp2	T	A	18: 24,631,404	S603T	probably benign	Het
Eml2	T	A	7: 19,196,254	L300H	probably damaging	Het
Esp3	A	G	17: 40,635,936	K50R	possibly damaging	Het
Esrp1	A	G	4: 11,379,375	F136L	probably damaging	Het
Exoc1	T	A	5: 76,559,164	D497E	probably damaging	Het
Fat3	A	G	9: 15,997,465	S2414P	probably damaging	Het
Foxj3	C	T	4: 119,620,201	P369S	unknown	Het
Gkn2	G	T	6: 87,375,939		probably null	Het
Gm17333	AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA	AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA	16: 77,852,878		noncoding transcript	Het
Gm21905	A	T	5: 67,946,381		probably benign	Het
Grhl1	T	A	12: 24,582,963		probably null	Het
Grk6	A	G	13: 55,452,154	Y221C	probably damaging	Het
Hcrtr1	T	A	4: 130,130,927	K389*	probably null	Het
Hk1	G	A	10: 62,284,784	R545C	probably damaging	Het
Hsp90b1	A	T	10: 86,696,795	I339N	probably benign	Het
Ikzf3	T	C	11: 98,490,446	R103G	probably damaging	Het
Itgad	A	C	7: 128,178,370	I141L	probably benign	Het
Jmjd6	T	A	11: 116,842,440	Y137F	probably benign	Het
Kcna1	A	G	6: 126,642,067	V430A	probably benign	Het
Klhl41	G	A	2: 69,670,740	V182I	probably benign	Het
Ldhb	C	A	6: 142,501,395	M64I	probably benign	Het
Lrrc23	A	G	6: 124,776,114	S190P	possibly damaging	Het
Mb21d1	A	G	9: 78,442,481	Y200H	probably damaging	Het
Mboat2	T	C	12: 24,959,030	V445A	probably benign	Het
Mlycd	G	A	8: 119,401,519	W188*	probably null	Het
Mpp3	C	T	11: 102,008,649	E349K	probably benign	Het
Myh4	A	G	11: 67,250,540	M780V	probably benign	Het
Myh6	G	A	14: 54,956,506	R809C	probably damaging	Het
Mylip	G	A	13: 45,406,570	V161M	possibly damaging	Het
Nrp1	G	A	8: 128,425,969	V220I	probably null	Het
Nup210	A	T	6: 91,034,841	N455K	probably benign	Het
Olfr116	A	T	17: 37,624,352	Y94*	probably null	Het
Olfr583	C	A	7: 103,051,588	Q97K	probably benign	Het
Pbld2	G	T	10: 63,053,953		probably null	Het
Pclo	C	G	5: 14,521,903	P434R	probably damaging	Het
Pdlim3	A	G	8: 45,896,763	K37E	probably damaging	Het
Prkdc	T	A	16: 15,772,106	I2611N	probably benign	Het
Prr12	T	C	7: 45,028,530	D2019G	unknown	Het
Rab27a	A	G	9: 73,095,403	T205A	probably benign	Het
Rcan3	A	G	4: 135,425,284	L42P	probably damaging	Het
Rchy1	T	C	5: 91,955,615		probably null	Het
Sema6a	T	C	18: 47,248,999	H827R	probably damaging	Het
Sertad4	A	G	1: 192,850,950		probably null	Het
Smarcd1	T	A	15: 99,707,383	C282S	probably damaging	Het
Speg	A	G	1: 75,401,222	T769A	possibly damaging	Het
Syne1	T	A	10: 5,347,875	K1141*	probably null	Het
Synpo2	T	C	3: 123,117,666	E110G	probably benign	Het
Tg	T	A	15: 66,850,502	D333E	probably benign	Het
Tmem132c	A	G	5: 127,359,891	Y148C	probably damaging	Het
Tmem215	T	A	4: 40,473,965	V14E	probably damaging	Het
Tmem229b	A	G	12: 78,964,911	L82P	probably damaging	Het
Togaram1	A	G	12: 64,966,265	T97A	probably benign	Het
Trappc9	G	A	15: 72,693,548	R965*	probably null	Het
Trio	T	C	15: 27,832,985	I104V	probably benign	Het
Trp73	A	G	4: 154,063,895	F354S	probably benign	Het
Ttyh2	T	C	11: 114,686,452	L63P	probably damaging	Het
Ulk4	G	C	9: 121,044,775	P1197A	probably damaging	Het
Vmn1r176	T	C	7: 23,835,111	M206V	possibly damaging	Het
Vps8	T	A	16: 21,466,476	Y402*	probably null	Het
Zbtb41	A	G	1: 139,423,193	I15V	probably benign	Het
Zc3hav1	T	C	6: 38,307,235	I982V	possibly damaging	Het
Zmynd19	T	A	2: 24,958,111	N106K	probably benign	Het

Other mutations in Kel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Kel	APN	6	41688575	missense	probably damaging	1.00
IGL00792:Kel	APN	6	41702012	missense	probably damaging	1.00
IGL00972:Kel	APN	6	41688066	missense	possibly damaging	0.62
IGL01121:Kel	APN	6	41702409	missense	probably benign	0.00
IGL01286:Kel	APN	6	41688117	splice site	probably null
IGL01461:Kel	APN	6	41701911	critical splice donor site	probably null
IGL01836:Kel	APN	6	41697438	missense	possibly damaging	0.50
IGL02037:Kel	APN	6	41697474	missense	probably benign	0.01
IGL02103:Kel	APN	6	41702389	missense	probably benign	0.18
IGL02604:Kel	APN	6	41687582	missense	probably damaging	0.98
IGL03102:Kel	APN	6	41702983	missense	probably benign	0.00
IGL03274:Kel	APN	6	41687995	splice site	probably null
IGL03355:Kel	APN	6	41698887	critical splice donor site	probably null
A4554:Kel	UTSW	6	41697419	missense	possibly damaging	0.95
R0121:Kel	UTSW	6	41702064	unclassified	probably benign
R0153:Kel	UTSW	6	41701943	missense	probably benign	0.08
R0535:Kel	UTSW	6	41690838	missense	probably null	0.21
R0658:Kel	UTSW	6	41703031	missense	probably damaging	1.00
R1005:Kel	UTSW	6	41688617	missense	probably damaging	1.00
R1199:Kel	UTSW	6	41688591	missense	possibly damaging	0.95
R1272:Kel	UTSW	6	41703470	missense	probably benign	0.00
R1880:Kel	UTSW	6	41687545	missense	possibly damaging	0.95
R2102:Kel	UTSW	6	41686484	missense	possibly damaging	0.86
R2118:Kel	UTSW	6	41689300	missense	probably benign
R2571:Kel	UTSW	6	41688067	missense	possibly damaging	0.62
R4209:Kel	UTSW	6	41698425	nonsense	probably null
R4210:Kel	UTSW	6	41698425	nonsense	probably null
R4260:Kel	UTSW	6	41686423	utr 3 prime	probably benign
R4382:Kel	UTSW	6	41698400	missense	probably benign	0.13
R5023:Kel	UTSW	6	41688111	missense	probably damaging	1.00
R5033:Kel	UTSW	6	41699055	missense	probably damaging	1.00
R5239:Kel	UTSW	6	41688114	nonsense	probably null
R5431:Kel	UTSW	6	41698420	missense	probably benign	0.23
R5742:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5745:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5746:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5978:Kel	UTSW	6	41688045	missense	probably benign	0.00
R6023:Kel	UTSW	6	41697475	missense	probably benign
R6109:Kel	UTSW	6	41688862	missense	probably benign	0.06
R6125:Kel	UTSW	6	41690786	missense	probably damaging	1.00
R6319:Kel	UTSW	6	41702447	missense	probably benign	0.05
R6368:Kel	UTSW	6	41688851	nonsense	probably null
R6864:Kel	UTSW	6	41703760	critical splice donor site	probably null
R6956:Kel	UTSW	6	41687973	missense	probably damaging	1.00
R7644:Kel	UTSW	6	41690808	missense	probably benign	0.03
R7938:Kel	UTSW	6	41698376	missense	probably benign	0.06
R8028:Kel	UTSW	6	41699024	missense	probably benign	0.21
R8082:Kel	UTSW	6	41703490	missense	possibly damaging	0.94
R8465:Kel	UTSW	6	41689538	critical splice donor site	probably null
R9158:Kel	UTSW	6	41687971	missense	probably benign	0.10
R9518:Kel	UTSW	6	41702400	missense	probably damaging	1.00
X0028:Kel	UTSW	6	41698351	missense	probably damaging	0.99
Z1176:Kel	UTSW	6	41687572	missense	probably damaging	1.00
Z1177:Kel	UTSW	6	41689559	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCGCCAAAGTTCACAGCTCTAAAG -3'
(R):5'- TGCATCAAATGACCTGCTGCCTC -3'

Sequencing Primer
(F):5'- TCACAGCTCTAAAGAGATGAGATCTG -3'
(R):5'- CCAGAAATGTCCAGAGCTTCTTG -3'

Posted On

2014-04-13