Incidental Mutation 'R1531:Cog4'
ID 166211
Institutional Source Beutler Lab
Gene Symbol Cog4
Ensembl Gene ENSMUSG00000031753
Gene Name component of oligomeric golgi complex 4
Synonyms D8Ertd515e
MMRRC Submission 039570-MU
Accession Numbers

Genbank: NM_133973; MGI: 2142808  

Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock # R1531 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 110846600-110882227 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110879721 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 613 (E613G)
Ref Sequence ENSEMBL: ENSMUSP00000133297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034203] [ENSMUST00000041382] [ENSMUST00000165867] [ENSMUST00000172542] [ENSMUST00000174398] [ENSMUST00000174679] [ENSMUST00000212971]
AlphaFold Q8R1U1
Predicted Effect probably benign
Transcript: ENSMUST00000034203
AA Change: E635G

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000034203
Gene: ENSMUSG00000031753
AA Change: E635G

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
coiled coil region 34 77 N/A INTRINSIC
Blast:Cog4 81 178 1e-53 BLAST
Cog4 188 498 1.81e-140 SMART
Pfam:RINT1_TIP1 536 773 3.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041382
SMART Domains Protein: ENSMUSP00000039271
Gene: ENSMUSG00000033703

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Pfam:Fucokinase 94 496 1.7e-101 PFAM
low complexity region 807 821 N/A INTRINSIC
Pfam:GHMP_kinases_N 827 894 3.6e-9 PFAM
Pfam:GHMP_kinases_C 970 1052 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165867
AA Change: E562G

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128518
Gene: ENSMUSG00000031753
AA Change: E562G

DomainStartEndE-ValueType
Blast:Cog4 8 105 6e-54 BLAST
Cog4 115 425 1.81e-140 SMART
PDB:3HR0|B 452 712 1e-174 PDB
Blast:DIL 621 702 6e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172497
Predicted Effect probably benign
Transcript: ENSMUST00000172542
SMART Domains Protein: ENSMUSP00000133283
Gene: ENSMUSG00000031753

DomainStartEndE-ValueType
Pfam:COG4 1 156 6.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174398
AA Change: E613G

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133297
Gene: ENSMUSG00000031753
AA Change: E613G

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
coiled coil region 33 76 N/A INTRINSIC
Blast:Cog4 80 177 9e-54 BLAST
Cog4 187 497 1.81e-140 SMART
PDB:3HR0|B 524 763 1e-153 PDB
Blast:DIL 672 753 7e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174679
SMART Domains Protein: ENSMUSP00000133458
Gene: ENSMUSG00000031753

DomainStartEndE-ValueType
Blast:Cog4 27 174 5e-60 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180679
Predicted Effect probably benign
Transcript: ENSMUST00000212971
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an oligomeric protein complex involved in the structure and function of the Golgi apparatus. Defects in this gene may be a cause of congenital disorder of glycosylation type IIj. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A G 10: 43,525,320 V211A probably benign Het
Agtpbp1 T A 13: 59,500,634 probably null Het
Aldh3b2 T G 19: 3,977,543 F28C probably damaging Het
Apaf1 T C 10: 91,054,521 N540S probably damaging Het
Apob T C 12: 7,997,880 I953T possibly damaging Het
Arhgef1 A G 7: 24,924,998 T816A probably damaging Het
Arid4a T A 12: 71,076,005 F1053L probably benign Het
Atxn1l A C 8: 109,732,059 F524V probably damaging Het
Cad T A 5: 31,076,219 M1874K probably benign Het
Ccdc40 G A 11: 119,263,189 V1096I probably benign Het
Ccdc93 A G 1: 121,480,822 D358G probably benign Het
Cd96 T C 16: 46,117,806 T99A probably benign Het
Cdc42ep3 A T 17: 79,335,044 M149K probably benign Het
Crebbp A T 16: 4,084,517 I2286N probably benign Het
Csf1 T C 3: 107,748,338 E459G possibly damaging Het
Csrp2 A T 10: 110,935,205 Y57F probably benign Het
Ctdspl C T 9: 119,040,582 P244L probably damaging Het
Cyp2c29 A G 19: 39,324,968 R303G probably damaging Het
Cyp4a10 C A 4: 115,518,435 Y38* probably null Het
Dmgdh T A 13: 93,744,411 I783N probably damaging Het
Efcc1 G A 6: 87,731,166 E92K probably benign Het
Eif2ak4 T A 2: 118,443,210 L872H probably damaging Het
Elp2 T A 18: 24,631,404 S603T probably benign Het
Eml2 T A 7: 19,196,254 L300H probably damaging Het
Esp3 A G 17: 40,635,936 K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 F136L probably damaging Het
Exoc1 T A 5: 76,559,164 D497E probably damaging Het
Fat3 A G 9: 15,997,465 S2414P probably damaging Het
Foxj3 C T 4: 119,620,201 P369S unknown Het
Gkn2 G T 6: 87,375,939 probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gm21905 A T 5: 67,946,381 probably benign Het
Grhl1 T A 12: 24,582,963 probably null Het
Grk6 A G 13: 55,452,154 Y221C probably damaging Het
Hcrtr1 T A 4: 130,130,927 K389* probably null Het
Hk1 G A 10: 62,284,784 R545C probably damaging Het
Hsp90b1 A T 10: 86,696,795 I339N probably benign Het
Ikzf3 T C 11: 98,490,446 R103G probably damaging Het
Itgad A C 7: 128,178,370 I141L probably benign Het
Jmjd6 T A 11: 116,842,440 Y137F probably benign Het
Kcna1 A G 6: 126,642,067 V430A probably benign Het
Kel A G 6: 41,688,626 V520A probably damaging Het
Klhl41 G A 2: 69,670,740 V182I probably benign Het
Ldhb C A 6: 142,501,395 M64I probably benign Het
Lrrc23 A G 6: 124,776,114 S190P possibly damaging Het
Mb21d1 A G 9: 78,442,481 Y200H probably damaging Het
Mboat2 T C 12: 24,959,030 V445A probably benign Het
Mlycd G A 8: 119,401,519 W188* probably null Het
Mpp3 C T 11: 102,008,649 E349K probably benign Het
Myh4 A G 11: 67,250,540 M780V probably benign Het
Myh6 G A 14: 54,956,506 R809C probably damaging Het
Mylip G A 13: 45,406,570 V161M possibly damaging Het
Nrp1 G A 8: 128,425,969 V220I probably null Het
Nup210 A T 6: 91,034,841 N455K probably benign Het
Olfr116 A T 17: 37,624,352 Y94* probably null Het
Olfr583 C A 7: 103,051,588 Q97K probably benign Het
Pbld2 G T 10: 63,053,953 probably null Het
Pclo C G 5: 14,521,903 P434R probably damaging Het
Pdlim3 A G 8: 45,896,763 K37E probably damaging Het
Prkdc T A 16: 15,772,106 I2611N probably benign Het
Prr12 T C 7: 45,028,530 D2019G unknown Het
Rab27a A G 9: 73,095,403 T205A probably benign Het
Rcan3 A G 4: 135,425,284 L42P probably damaging Het
Rchy1 T C 5: 91,955,615 probably null Het
Sema6a T C 18: 47,248,999 H827R probably damaging Het
Sertad4 A G 1: 192,850,950 probably null Het
Smarcd1 T A 15: 99,707,383 C282S probably damaging Het
Speg A G 1: 75,401,222 T769A possibly damaging Het
Syne1 T A 10: 5,347,875 K1141* probably null Het
Synpo2 T C 3: 123,117,666 E110G probably benign Het
Tg T A 15: 66,850,502 D333E probably benign Het
Tmem132c A G 5: 127,359,891 Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 V14E probably damaging Het
Tmem229b A G 12: 78,964,911 L82P probably damaging Het
Togaram1 A G 12: 64,966,265 T97A probably benign Het
Trappc9 G A 15: 72,693,548 R965* probably null Het
Trio T C 15: 27,832,985 I104V probably benign Het
Trp73 A G 4: 154,063,895 F354S probably benign Het
Ttyh2 T C 11: 114,686,452 L63P probably damaging Het
Ulk4 G C 9: 121,044,775 P1197A probably damaging Het
Vmn1r176 T C 7: 23,835,111 M206V possibly damaging Het
Vps8 T A 16: 21,466,476 Y402* probably null Het
Zbtb41 A G 1: 139,423,193 I15V probably benign Het
Zc3hav1 T C 6: 38,307,235 I982V possibly damaging Het
Zmynd19 T A 2: 24,958,111 N106K probably benign Het
Other mutations in Cog4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Cog4 APN 8 110866085 missense probably benign 0.44
IGL01631:Cog4 APN 8 110881840 missense probably damaging 1.00
IGL01756:Cog4 APN 8 110853759 nonsense probably null
IGL02850:Cog4 APN 8 110866589 missense possibly damaging 0.46
IGL02932:Cog4 APN 8 110852433 missense probably benign 0.16
IGL03232:Cog4 APN 8 110880682 splice site probably null
Deminimis UTSW 8 110881480 missense probably damaging 0.98
PIT4362001:Cog4 UTSW 8 110866672 missense probably damaging 1.00
R0350:Cog4 UTSW 8 110853696 missense possibly damaging 0.73
R1368:Cog4 UTSW 8 110858525 unclassified probably benign
R2110:Cog4 UTSW 8 110858582 missense possibly damaging 0.62
R2112:Cog4 UTSW 8 110858582 missense possibly damaging 0.62
R2867:Cog4 UTSW 8 110866659 intron probably benign
R4239:Cog4 UTSW 8 110858612 missense probably damaging 0.98
R4867:Cog4 UTSW 8 110866610 missense probably damaging 1.00
R4967:Cog4 UTSW 8 110852283 splice site probably null
R5124:Cog4 UTSW 8 110847193 missense probably damaging 1.00
R5655:Cog4 UTSW 8 110863307 missense probably damaging 1.00
R6024:Cog4 UTSW 8 110881480 missense probably damaging 0.98
R6347:Cog4 UTSW 8 110880643 missense probably damaging 1.00
R6475:Cog4 UTSW 8 110880894 missense possibly damaging 0.74
R6526:Cog4 UTSW 8 110881786 missense probably damaging 1.00
R6542:Cog4 UTSW 8 110851362 missense probably damaging 1.00
R6545:Cog4 UTSW 8 110880945 missense probably damaging 1.00
R7248:Cog4 UTSW 8 110882202 missense unknown
R7292:Cog4 UTSW 8 110881828 missense probably damaging 1.00
R7356:Cog4 UTSW 8 110849866 critical splice acceptor site probably null
R7440:Cog4 UTSW 8 110879706 missense probably benign 0.06
R7751:Cog4 UTSW 8 110880968 missense probably damaging 1.00
R8170:Cog4 UTSW 8 110866031 missense probably damaging 0.98
R8181:Cog4 UTSW 8 110852085 splice site probably null
R8834:Cog4 UTSW 8 110881417 missense probably damaging 1.00
R8837:Cog4 UTSW 8 110852372 missense probably benign 0.45
R9155:Cog4 UTSW 8 110881752 missense probably damaging 1.00
R9469:Cog4 UTSW 8 110882172 missense unknown
Z1177:Cog4 UTSW 8 110879015 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATACTTGACTGTAGCCACAGGCAC -3'
(R):5'- AAGGCAGGTCCCTTCACATGTCTC -3'

Sequencing Primer
(F):5'- TCTGGACCTGAATCTGCACAG -3'
(R):5'- CTGAGCCATTCTTAGGCCCAC -3'
Posted On 2014-04-13