Incidental Mutation 'R1531:Nrp1'
ID 166213
Institutional Source Beutler Lab
Gene Symbol Nrp1
Ensembl Gene ENSMUSG00000025810
Gene Name neuropilin 1
Synonyms NP-1, Neuropilin-1, Npn1, NPN-1
MMRRC Submission 039570-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1531 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 129085085-129229844 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 129152450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 220 (V220I)
Ref Sequence ENSEMBL: ENSMUSP00000026917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026917]
AlphaFold P97333
PDB Structure Mouse Neuropilin-1, extracellular domains 1-4 (a1a2b1b2) [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000026917
AA Change: V220I

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026917
Gene: ENSMUSG00000025810
AA Change: V220I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CUB 27 141 1.44e-43 SMART
CUB 147 265 9.19e-42 SMART
FA58C 274 424 5.21e-44 SMART
FA58C 430 583 4.15e-20 SMART
low complexity region 587 599 N/A INTRINSIC
MAM 645 811 4.94e-69 SMART
Pfam:DUF3481 837 920 3.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212933
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice show embryonic death, impaired neuronal migration and axon guidance, and vascular defects including a disorganized yolk sac vascular plexus, and malformed brachial arch arteries and great vessels. Mice lacking the cytoplasmic domain show altered retinal arteriovenous patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T A 13: 59,648,448 (GRCm39) probably null Het
Aldh3b2 T G 19: 4,027,543 (GRCm39) F28C probably damaging Het
Apaf1 T C 10: 90,890,383 (GRCm39) N540S probably damaging Het
Apob T C 12: 8,047,880 (GRCm39) I953T possibly damaging Het
Arhgef1 A G 7: 24,624,423 (GRCm39) T816A probably damaging Het
Arid4a T A 12: 71,122,779 (GRCm39) F1053L probably benign Het
Atxn1l A C 8: 110,458,691 (GRCm39) F524V probably damaging Het
Cad T A 5: 31,233,563 (GRCm39) M1874K probably benign Het
Ccdc40 G A 11: 119,154,015 (GRCm39) V1096I probably benign Het
Ccdc93 A G 1: 121,408,551 (GRCm39) D358G probably benign Het
Cd96 T C 16: 45,938,169 (GRCm39) T99A probably benign Het
Cdc42ep3 A T 17: 79,642,473 (GRCm39) M149K probably benign Het
Cgas A G 9: 78,349,763 (GRCm39) Y200H probably damaging Het
Cog4 A G 8: 111,606,353 (GRCm39) E613G probably benign Het
Crebbp A T 16: 3,902,381 (GRCm39) I2286N probably benign Het
Csf1 T C 3: 107,655,654 (GRCm39) E459G possibly damaging Het
Csrp2 A T 10: 110,771,066 (GRCm39) Y57F probably benign Het
Ctdspl C T 9: 118,869,650 (GRCm39) P244L probably damaging Het
Cyp2c29 A G 19: 39,313,412 (GRCm39) R303G probably damaging Het
Cyp4a10 C A 4: 115,375,632 (GRCm39) Y38* probably null Het
Dmgdh T A 13: 93,880,919 (GRCm39) I783N probably damaging Het
Efcc1 G A 6: 87,708,148 (GRCm39) E92K probably benign Het
Eif2ak4 T A 2: 118,273,691 (GRCm39) L872H probably damaging Het
Elp2 T A 18: 24,764,461 (GRCm39) S603T probably benign Het
Eml2 T A 7: 18,930,179 (GRCm39) L300H probably damaging Het
Esp3 A G 17: 40,946,827 (GRCm39) K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 (GRCm39) F136L probably damaging Het
Exoc1 T A 5: 76,707,011 (GRCm39) D497E probably damaging Het
Fat3 A G 9: 15,908,761 (GRCm39) S2414P probably damaging Het
Foxj3 C T 4: 119,477,398 (GRCm39) P369S unknown Het
Gkn2 G T 6: 87,352,921 (GRCm39) probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,649,766 (GRCm39) noncoding transcript Het
Gm21905 A T 5: 68,103,724 (GRCm39) probably benign Het
Grhl1 T A 12: 24,632,962 (GRCm39) probably null Het
Grk6 A G 13: 55,599,967 (GRCm39) Y221C probably damaging Het
Hcrtr1 T A 4: 130,024,720 (GRCm39) K389* probably null Het
Hk1 G A 10: 62,120,563 (GRCm39) R545C probably damaging Het
Hsp90b1 A T 10: 86,532,659 (GRCm39) I339N probably benign Het
Ikzf3 T C 11: 98,381,272 (GRCm39) R103G probably damaging Het
Itgad A C 7: 127,777,542 (GRCm39) I141L probably benign Het
Jmjd6 T A 11: 116,733,266 (GRCm39) Y137F probably benign Het
Kcna1 A G 6: 126,619,030 (GRCm39) V430A probably benign Het
Kel A G 6: 41,665,560 (GRCm39) V520A probably damaging Het
Klhl41 G A 2: 69,501,084 (GRCm39) V182I probably benign Het
Ldhb C A 6: 142,447,121 (GRCm39) M64I probably benign Het
Lrrc23 A G 6: 124,753,077 (GRCm39) S190P possibly damaging Het
Mboat2 T C 12: 25,009,029 (GRCm39) V445A probably benign Het
Mlycd G A 8: 120,128,258 (GRCm39) W188* probably null Het
Mpp3 C T 11: 101,899,475 (GRCm39) E349K probably benign Het
Mtres1 A G 10: 43,401,316 (GRCm39) V211A probably benign Het
Myh4 A G 11: 67,141,366 (GRCm39) M780V probably benign Het
Myh6 G A 14: 55,193,963 (GRCm39) R809C probably damaging Het
Mylip G A 13: 45,560,046 (GRCm39) V161M possibly damaging Het
Nup210 A T 6: 91,011,823 (GRCm39) N455K probably benign Het
Or14j10 A T 17: 37,935,243 (GRCm39) Y94* probably null Het
Or51f1d C A 7: 102,700,795 (GRCm39) Q97K probably benign Het
Pbld2 G T 10: 62,889,732 (GRCm39) probably null Het
Pclo C G 5: 14,571,917 (GRCm39) P434R probably damaging Het
Pdlim3 A G 8: 46,349,800 (GRCm39) K37E probably damaging Het
Prkdc T A 16: 15,589,970 (GRCm39) I2611N probably benign Het
Prr12 T C 7: 44,677,954 (GRCm39) D2019G unknown Het
Rab27a A G 9: 73,002,685 (GRCm39) T205A probably benign Het
Rcan3 A G 4: 135,152,595 (GRCm39) L42P probably damaging Het
Rchy1 T C 5: 92,103,474 (GRCm39) probably null Het
Sema6a T C 18: 47,382,066 (GRCm39) H827R probably damaging Het
Sertad4 A G 1: 192,533,258 (GRCm39) probably null Het
Smarcd1 T A 15: 99,605,264 (GRCm39) C282S probably damaging Het
Speg A G 1: 75,377,866 (GRCm39) T769A possibly damaging Het
Syne1 T A 10: 5,297,875 (GRCm39) K1141* probably null Het
Synpo2 T C 3: 122,911,315 (GRCm39) E110G probably benign Het
Tg T A 15: 66,722,351 (GRCm39) D333E probably benign Het
Tmem132c A G 5: 127,436,955 (GRCm39) Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 (GRCm39) V14E probably damaging Het
Tmem229b A G 12: 79,011,685 (GRCm39) L82P probably damaging Het
Togaram1 A G 12: 65,013,039 (GRCm39) T97A probably benign Het
Trappc9 G A 15: 72,565,397 (GRCm39) R965* probably null Het
Trio T C 15: 27,833,071 (GRCm39) I104V probably benign Het
Trp73 A G 4: 154,148,352 (GRCm39) F354S probably benign Het
Ttyh2 T C 11: 114,577,278 (GRCm39) L63P probably damaging Het
Ulk4 G C 9: 120,873,841 (GRCm39) P1197A probably damaging Het
Vmn1r176 T C 7: 23,534,536 (GRCm39) M206V possibly damaging Het
Vps8 T A 16: 21,285,226 (GRCm39) Y402* probably null Het
Zbtb41 A G 1: 139,350,931 (GRCm39) I15V probably benign Het
Zc3hav1 T C 6: 38,284,170 (GRCm39) I982V possibly damaging Het
Zmynd19 T A 2: 24,848,123 (GRCm39) N106K probably benign Het
Other mutations in Nrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrp1 APN 8 129,202,688 (GRCm39) missense probably benign
IGL01412:Nrp1 APN 8 129,145,188 (GRCm39) splice site probably benign
IGL01586:Nrp1 APN 8 129,158,513 (GRCm39) missense possibly damaging 0.86
IGL02307:Nrp1 APN 8 129,229,201 (GRCm39) missense probably damaging 1.00
IGL02500:Nrp1 APN 8 129,152,280 (GRCm39) missense possibly damaging 0.94
IGL02547:Nrp1 APN 8 129,219,512 (GRCm39) missense probably benign
R0046:Nrp1 UTSW 8 129,227,089 (GRCm39) splice site probably benign
R0281:Nrp1 UTSW 8 129,187,164 (GRCm39) missense probably damaging 0.96
R0403:Nrp1 UTSW 8 129,184,450 (GRCm39) missense probably damaging 1.00
R0610:Nrp1 UTSW 8 129,229,099 (GRCm39) missense probably damaging 1.00
R1055:Nrp1 UTSW 8 129,195,079 (GRCm39) missense possibly damaging 0.68
R1229:Nrp1 UTSW 8 129,145,197 (GRCm39) nonsense probably null
R1263:Nrp1 UTSW 8 129,194,870 (GRCm39) missense probably damaging 1.00
R1340:Nrp1 UTSW 8 129,160,836 (GRCm39) missense probably damaging 1.00
R1397:Nrp1 UTSW 8 129,145,197 (GRCm39) nonsense probably null
R1462:Nrp1 UTSW 8 129,229,279 (GRCm39) missense probably benign
R1462:Nrp1 UTSW 8 129,229,279 (GRCm39) missense probably benign
R1587:Nrp1 UTSW 8 129,202,763 (GRCm39) missense probably damaging 1.00
R1719:Nrp1 UTSW 8 129,152,366 (GRCm39) missense probably damaging 1.00
R1733:Nrp1 UTSW 8 129,194,974 (GRCm39) missense probably benign 0.02
R1785:Nrp1 UTSW 8 129,224,997 (GRCm39) missense probably damaging 1.00
R1786:Nrp1 UTSW 8 129,224,997 (GRCm39) missense probably damaging 1.00
R2047:Nrp1 UTSW 8 129,224,577 (GRCm39) splice site probably benign
R2130:Nrp1 UTSW 8 129,224,997 (GRCm39) missense probably damaging 1.00
R2132:Nrp1 UTSW 8 129,224,997 (GRCm39) missense probably damaging 1.00
R2133:Nrp1 UTSW 8 129,224,997 (GRCm39) missense probably damaging 1.00
R2163:Nrp1 UTSW 8 129,224,352 (GRCm39) missense probably damaging 1.00
R2338:Nrp1 UTSW 8 129,224,385 (GRCm39) missense probably benign 0.01
R2407:Nrp1 UTSW 8 129,158,426 (GRCm39) missense probably damaging 0.99
R3405:Nrp1 UTSW 8 129,224,569 (GRCm39) nonsense probably null
R3748:Nrp1 UTSW 8 129,184,461 (GRCm39) missense probably damaging 1.00
R4347:Nrp1 UTSW 8 129,207,472 (GRCm39) critical splice donor site probably null
R4379:Nrp1 UTSW 8 129,194,948 (GRCm39) missense probably damaging 1.00
R4646:Nrp1 UTSW 8 129,184,425 (GRCm39) missense probably benign 0.00
R4688:Nrp1 UTSW 8 129,229,047 (GRCm39) missense probably benign 0.01
R4916:Nrp1 UTSW 8 129,229,285 (GRCm39) nonsense probably null
R5077:Nrp1 UTSW 8 129,227,154 (GRCm39) critical splice donor site probably null
R5301:Nrp1 UTSW 8 129,160,678 (GRCm39) splice site probably null
R5509:Nrp1 UTSW 8 129,152,396 (GRCm39) missense possibly damaging 0.73
R5745:Nrp1 UTSW 8 129,194,929 (GRCm39) missense probably benign 0.22
R5873:Nrp1 UTSW 8 129,194,858 (GRCm39) missense probably damaging 1.00
R5987:Nrp1 UTSW 8 129,202,650 (GRCm39) missense probably damaging 1.00
R6060:Nrp1 UTSW 8 129,224,419 (GRCm39) missense probably damaging 1.00
R6757:Nrp1 UTSW 8 129,152,349 (GRCm39) missense probably damaging 1.00
R6889:Nrp1 UTSW 8 129,219,538 (GRCm39) missense probably damaging 1.00
R7025:Nrp1 UTSW 8 129,207,435 (GRCm39) missense probably damaging 1.00
R7065:Nrp1 UTSW 8 129,187,193 (GRCm39) missense probably benign
R7290:Nrp1 UTSW 8 129,202,777 (GRCm39) critical splice donor site probably null
R7369:Nrp1 UTSW 8 129,158,396 (GRCm39) missense probably damaging 1.00
R7553:Nrp1 UTSW 8 129,158,468 (GRCm39) missense probably damaging 1.00
R7650:Nrp1 UTSW 8 129,224,495 (GRCm39) missense possibly damaging 0.87
R8043:Nrp1 UTSW 8 129,158,504 (GRCm39) missense probably benign 0.00
R8088:Nrp1 UTSW 8 129,194,997 (GRCm39) nonsense probably null
R8193:Nrp1 UTSW 8 129,187,187 (GRCm39) missense probably damaging 1.00
R8206:Nrp1 UTSW 8 129,184,438 (GRCm39) missense probably damaging 0.99
R8245:Nrp1 UTSW 8 129,214,434 (GRCm39) missense probably benign
R8684:Nrp1 UTSW 8 129,085,885 (GRCm39) start gained probably benign
R8734:Nrp1 UTSW 8 129,207,420 (GRCm39) missense probably benign 0.23
R8875:Nrp1 UTSW 8 129,207,472 (GRCm39) critical splice donor site probably null
R9054:Nrp1 UTSW 8 129,214,389 (GRCm39) missense probably benign
R9253:Nrp1 UTSW 8 129,229,144 (GRCm39) missense possibly damaging 0.47
R9301:Nrp1 UTSW 8 129,089,859 (GRCm39) missense probably damaging 1.00
R9437:Nrp1 UTSW 8 129,187,108 (GRCm39) missense probably benign 0.01
R9606:Nrp1 UTSW 8 129,229,029 (GRCm39) missense probably benign 0.00
R9607:Nrp1 UTSW 8 129,152,262 (GRCm39) missense probably benign 0.01
R9691:Nrp1 UTSW 8 129,202,650 (GRCm39) missense probably damaging 1.00
X0066:Nrp1 UTSW 8 129,187,126 (GRCm39) missense possibly damaging 0.95
Z1186:Nrp1 UTSW 8 129,224,419 (GRCm39) missense probably damaging 1.00
Z1189:Nrp1 UTSW 8 129,224,419 (GRCm39) missense probably damaging 1.00
Z1192:Nrp1 UTSW 8 129,224,419 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATAAAGTCCCCTGGGTTCCCTG -3'
(R):5'- CTGAGCACCATTTCAGCAACATAGC -3'

Sequencing Primer
(F):5'- CCCTGGGTTCCCTGAAAAATAC -3'
(R):5'- GTGTTGACCTCTAGGATATCACAG -3'
Posted On 2014-04-13