Incidental Mutation 'R1531:Syne1'
ID166219
Institutional Source Beutler Lab
Gene Symbol Syne1
Ensembl Gene ENSMUSG00000096054
Gene Namespectrin repeat containing, nuclear envelope 1
SynonymsA330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik
MMRRC Submission 039570-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1531 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location5020917-5551482 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 5347875 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1141 (K1141*)
Ref Sequence ENSEMBL: ENSMUSP00000150262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041639] [ENSMUST00000215295]
Predicted Effect probably null
Transcript: ENSMUST00000041639
AA Change: K1141*
SMART Domains Protein: ENSMUSP00000039440
Gene: ENSMUSG00000096054
AA Change: K1141*

DomainStartEndE-ValueType
CH 29 139 4.55e-14 SMART
low complexity region 145 167 N/A INTRINSIC
CH 187 285 9.67e-18 SMART
coiled coil region 425 452 N/A INTRINSIC
Blast:SPEC 493 599 2e-28 BLAST
Blast:SPEC 606 695 7e-40 BLAST
Blast:SPEC 701 815 1e-32 BLAST
Blast:SPEC 815 913 4e-41 BLAST
Blast:SPEC 920 1013 9e-53 BLAST
Blast:SPEC 1117 1219 2e-60 BLAST
coiled coil region 1267 1329 N/A INTRINSIC
low complexity region 1349 1368 N/A INTRINSIC
coiled coil region 1399 1427 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000215295
AA Change: K1141*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215887
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A G 10: 43,525,320 V211A probably benign Het
Agtpbp1 T A 13: 59,500,634 probably null Het
Aldh3b2 T G 19: 3,977,543 F28C probably damaging Het
Apaf1 T C 10: 91,054,521 N540S probably damaging Het
Apob T C 12: 7,997,880 I953T possibly damaging Het
Arhgef1 A G 7: 24,924,998 T816A probably damaging Het
Arid4a T A 12: 71,076,005 F1053L probably benign Het
Atxn1l A C 8: 109,732,059 F524V probably damaging Het
Cad T A 5: 31,076,219 M1874K probably benign Het
Ccdc40 G A 11: 119,263,189 V1096I probably benign Het
Ccdc93 A G 1: 121,480,822 D358G probably benign Het
Cd96 T C 16: 46,117,806 T99A probably benign Het
Cdc42ep3 A T 17: 79,335,044 M149K probably benign Het
Cog4 A G 8: 110,879,721 E613G probably benign Het
Crebbp A T 16: 4,084,517 I2286N probably benign Het
Csf1 T C 3: 107,748,338 E459G possibly damaging Het
Csrp2 A T 10: 110,935,205 Y57F probably benign Het
Ctdspl C T 9: 119,040,582 P244L probably damaging Het
Cyp2c29 A G 19: 39,324,968 R303G probably damaging Het
Cyp4a10 C A 4: 115,518,435 Y38* probably null Het
Dmgdh T A 13: 93,744,411 I783N probably damaging Het
Efcc1 G A 6: 87,731,166 E92K probably benign Het
Eif2ak4 T A 2: 118,443,210 L872H probably damaging Het
Elp2 T A 18: 24,631,404 S603T probably benign Het
Eml2 T A 7: 19,196,254 L300H probably damaging Het
Esp3 A G 17: 40,635,936 K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 F136L probably damaging Het
Exoc1 T A 5: 76,559,164 D497E probably damaging Het
Fat3 A G 9: 15,997,465 S2414P probably damaging Het
Foxj3 C T 4: 119,620,201 P369S unknown Het
Gkn2 G T 6: 87,375,939 probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Gm21905 A T 5: 67,946,381 probably benign Het
Grhl1 T A 12: 24,582,963 probably null Het
Grk6 A G 13: 55,452,154 Y221C probably damaging Het
Hcrtr1 T A 4: 130,130,927 K389* probably null Het
Hk1 G A 10: 62,284,784 R545C probably damaging Het
Hsp90b1 A T 10: 86,696,795 I339N probably benign Het
Ikzf3 T C 11: 98,490,446 R103G probably damaging Het
Itgad A C 7: 128,178,370 I141L probably benign Het
Jmjd6 T A 11: 116,842,440 Y137F probably benign Het
Kcna1 A G 6: 126,642,067 V430A probably benign Het
Kel A G 6: 41,688,626 V520A probably damaging Het
Klhl41 G A 2: 69,670,740 V182I probably benign Het
Ldhb C A 6: 142,501,395 M64I probably benign Het
Lrrc23 A G 6: 124,776,114 S190P possibly damaging Het
Mb21d1 A G 9: 78,442,481 Y200H probably damaging Het
Mboat2 T C 12: 24,959,030 V445A probably benign Het
Mlycd G A 8: 119,401,519 W188* probably null Het
Mpp3 C T 11: 102,008,649 E349K probably benign Het
Myh4 A G 11: 67,250,540 M780V probably benign Het
Myh6 G A 14: 54,956,506 R809C probably damaging Het
Mylip G A 13: 45,406,570 V161M possibly damaging Het
Nrp1 G A 8: 128,425,969 V220I probably null Het
Nup210 A T 6: 91,034,841 N455K probably benign Het
Olfr116 A T 17: 37,624,352 Y94* probably null Het
Olfr583 C A 7: 103,051,588 Q97K probably benign Het
Pbld2 G T 10: 63,053,953 probably null Het
Pclo C G 5: 14,521,903 P434R probably damaging Het
Pdlim3 A G 8: 45,896,763 K37E probably damaging Het
Prkdc T A 16: 15,772,106 I2611N probably benign Het
Prr12 T C 7: 45,028,530 D2019G unknown Het
Rab27a A G 9: 73,095,403 T205A probably benign Het
Rcan3 A G 4: 135,425,284 L42P probably damaging Het
Rchy1 T C 5: 91,955,615 probably null Het
Sema6a T C 18: 47,248,999 H827R probably damaging Het
Sertad4 A G 1: 192,850,950 probably null Het
Smarcd1 T A 15: 99,707,383 C282S probably damaging Het
Speg A G 1: 75,401,222 T769A possibly damaging Het
Synpo2 T C 3: 123,117,666 E110G probably benign Het
Tg T A 15: 66,850,502 D333E probably benign Het
Tmem132c A G 5: 127,359,891 Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 V14E probably damaging Het
Tmem229b A G 12: 78,964,911 L82P probably damaging Het
Togaram1 A G 12: 64,966,265 T97A probably benign Het
Trappc9 G A 15: 72,693,548 R965* probably null Het
Trio T C 15: 27,832,985 I104V probably benign Het
Trp73 A G 4: 154,063,895 F354S probably benign Het
Ttyh2 T C 11: 114,686,452 L63P probably damaging Het
Ulk4 G C 9: 121,044,775 P1197A probably damaging Het
Vmn1r176 T C 7: 23,835,111 M206V possibly damaging Het
Vps8 T A 16: 21,466,476 Y402* probably null Het
Zbtb41 A G 1: 139,423,193 I15V probably benign Het
Zc3hav1 T C 6: 38,307,235 I982V possibly damaging Het
Zmynd19 T A 2: 24,958,111 N106K probably benign Het
Other mutations in Syne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Syne1 APN 10 5342167 synonymous probably benign
IGL00725:Syne1 APN 10 5344922 missense possibly damaging 0.48
IGL00799:Syne1 APN 10 5347878 missense probably benign 0.00
IGL01087:Syne1 APN 10 5425708 missense probably damaging 1.00
IGL01123:Syne1 APN 10 5344921 nonsense probably null
IGL01147:Syne1 APN 10 5052691 nonsense probably null
IGL01150:Syne1 APN 10 5443154 missense probably damaging 1.00
IGL01154:Syne1 APN 10 5360848 missense probably damaging 1.00
IGL01727:Syne1 APN 10 5047842 missense probably damaging 0.99
IGL01761:Syne1 APN 10 5405456 missense probably damaging 1.00
IGL01793:Syne1 APN 10 5352191 missense possibly damaging 0.67
IGL01961:Syne1 APN 10 5043723 missense possibly damaging 0.94
IGL01975:Syne1 APN 10 5068908 intron probably benign
IGL02152:Syne1 APN 10 5424382 missense probably damaging 1.00
IGL02423:Syne1 APN 10 5368295 missense probably benign 0.00
IGL02457:Syne1 APN 10 5342167 missense probably damaging 1.00
IGL02543:Syne1 APN 10 5043618 missense probably damaging 0.97
IGL02836:Syne1 APN 10 5409875 splice site probably benign
IGL03141:Syne1 APN 10 5424261 missense probably damaging 1.00
FR4548:Syne1 UTSW 10 5032969 missense probably benign 0.09
IGL02799:Syne1 UTSW 10 5359059 missense probably damaging 1.00
PIT4305001:Syne1 UTSW 10 5333023 missense probably damaging 1.00
PIT4687001:Syne1 UTSW 10 5358390 missense possibly damaging 0.87
R0004:Syne1 UTSW 10 5443132 splice site probably benign
R0110:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0165:Syne1 UTSW 10 5033096 missense probably benign 0.28
R0194:Syne1 UTSW 10 5424311 missense probably benign
R0311:Syne1 UTSW 10 5348943 missense possibly damaging 0.92
R0328:Syne1 UTSW 10 5348945 missense possibly damaging 0.62
R0379:Syne1 UTSW 10 5541989 missense probably damaging 1.00
R0387:Syne1 UTSW 10 5351029 missense probably benign
R0452:Syne1 UTSW 10 5405435 missense probably damaging 0.98
R0456:Syne1 UTSW 10 5342252 missense probably benign 0.04
R0457:Syne1 UTSW 10 5022041 missense probably damaging 1.00
R0469:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0510:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0533:Syne1 UTSW 10 5358438 missense probably benign 0.00
R0617:Syne1 UTSW 10 5350933 missense probably damaging 1.00
R0690:Syne1 UTSW 10 5033138 splice site probably benign
R0964:Syne1 UTSW 10 5043652 missense possibly damaging 0.95
R1133:Syne1 UTSW 10 5349044 missense possibly damaging 0.77
R1327:Syne1 UTSW 10 5048925 splice site probably benign
R1339:Syne1 UTSW 10 5367571 missense probably damaging 1.00
R1558:Syne1 UTSW 10 5349280 nonsense probably null
R1633:Syne1 UTSW 10 5349388 missense probably damaging 1.00
R1642:Syne1 UTSW 10 5348694 missense possibly damaging 0.94
R1658:Syne1 UTSW 10 5367616 missense probably benign 0.03
R1753:Syne1 UTSW 10 5367621 missense probably benign 0.28
R1759:Syne1 UTSW 10 5349369 missense probably damaging 1.00
R1792:Syne1 UTSW 10 5040975 missense probably damaging 1.00
R2076:Syne1 UTSW 10 5040897 missense probably damaging 0.99
R2079:Syne1 UTSW 10 5361502 missense probably benign 0.01
R2102:Syne1 UTSW 10 5056514 missense probably damaging 1.00
R2233:Syne1 UTSW 10 5041484 missense probably benign 0.01
R2305:Syne1 UTSW 10 5047573 missense probably damaging 0.97
R3435:Syne1 UTSW 10 5348565 missense probably damaging 1.00
R3749:Syne1 UTSW 10 5052267 splice site probably benign
R3876:Syne1 UTSW 10 5052345 missense possibly damaging 0.57
R3895:Syne1 UTSW 10 5405456 missense probably damaging 0.98
R3974:Syne1 UTSW 10 5043630 missense probably benign 0.06
R4042:Syne1 UTSW 10 5041584 missense probably benign 0.21
R4120:Syne1 UTSW 10 5409798 missense probably damaging 1.00
R4201:Syne1 UTSW 10 5347870 missense probably benign
R4364:Syne1 UTSW 10 5353987 missense probably damaging 0.96
R4498:Syne1 UTSW 10 5031768 missense probably benign 0.00
R4767:Syne1 UTSW 10 5344866 nonsense probably null
R4804:Syne1 UTSW 10 5349310 missense possibly damaging 0.95
R4917:Syne1 UTSW 10 5057909 missense probably damaging 1.00
R4930:Syne1 UTSW 10 5052777 missense probably damaging 0.99
R5081:Syne1 UTSW 10 5047767 missense probably benign 0.04
R5089:Syne1 UTSW 10 5405444 nonsense probably null
R5174:Syne1 UTSW 10 5041490 missense probably damaging 0.99
R5205:Syne1 UTSW 10 5052295 missense probably benign 0.05
R5303:Syne1 UTSW 10 5420464 missense probably benign 0.00
R5384:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5385:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5392:Syne1 UTSW 10 5348661 missense probably damaging 1.00
R5442:Syne1 UTSW 10 5343473 missense probably benign 0.09
R5750:Syne1 UTSW 10 5339209 missense probably benign 0.01
R5935:Syne1 UTSW 10 5360706 unclassified probably null
R6015:Syne1 UTSW 10 5346819 critical splice donor site probably null
R6023:Syne1 UTSW 10 5443223 missense probably benign 0.09
R6049:Syne1 UTSW 10 5347926 missense possibly damaging 0.79
R6084:Syne1 UTSW 10 5348994 missense probably damaging 1.00
R6145:Syne1 UTSW 10 5052750 missense probably damaging 1.00
R6164:Syne1 UTSW 10 5061429 missense probably damaging 1.00
R6165:Syne1 UTSW 10 5425678 missense probably damaging 1.00
R6198:Syne1 UTSW 10 5302269 missense probably damaging 0.99
R6217:Syne1 UTSW 10 5293761 missense probably benign 0.00
R6247:Syne1 UTSW 10 5349071 missense probably damaging 0.98
R6271:Syne1 UTSW 10 5234652 missense probably damaging 1.00
R6338:Syne1 UTSW 10 5255475 missense probably benign 0.00
R6344:Syne1 UTSW 10 5022212 missense probably benign 0.08
R6434:Syne1 UTSW 10 5318422 missense probably benign 0.01
R6476:Syne1 UTSW 10 5154531 missense possibly damaging 0.88
R6479:Syne1 UTSW 10 5231679 nonsense probably null
R6479:Syne1 UTSW 10 5456826 missense probably damaging 1.00
R6546:Syne1 UTSW 10 5218645 nonsense probably null
R6578:Syne1 UTSW 10 5405454 nonsense probably null
R6611:Syne1 UTSW 10 5045273 missense probably benign 0.01
R6615:Syne1 UTSW 10 5301340 missense probably damaging 0.98
R6632:Syne1 UTSW 10 5215667 critical splice donor site probably null
R6662:Syne1 UTSW 10 5128416 missense probably damaging 1.00
R6677:Syne1 UTSW 10 5040942 missense possibly damaging 0.82
R6764:Syne1 UTSW 10 5229011 nonsense probably null
R6765:Syne1 UTSW 10 5143285 intron probably null
R6778:Syne1 UTSW 10 5102406 missense probably damaging 0.97
R6851:Syne1 UTSW 10 5262703 nonsense probably null
R6878:Syne1 UTSW 10 5420388 missense possibly damaging 0.78
R6883:Syne1 UTSW 10 5231704 nonsense probably null
R6910:Syne1 UTSW 10 5048887 missense probably benign 0.01
R6916:Syne1 UTSW 10 5227912 missense probably benign 0.00
R6925:Syne1 UTSW 10 5126682 missense probably benign 0.00
R6943:Syne1 UTSW 10 5083940 missense probably benign
R6947:Syne1 UTSW 10 5175789 missense probably damaging 1.00
R6965:Syne1 UTSW 10 5229120 missense possibly damaging 0.66
R6968:Syne1 UTSW 10 5117041 missense probably benign 0.09
R7043:Syne1 UTSW 10 5072193 missense possibly damaging 0.77
R7059:Syne1 UTSW 10 5346859 missense probably damaging 1.00
R7067:Syne1 UTSW 10 5234586 missense probably damaging 1.00
R7087:Syne1 UTSW 10 5542024 start gained probably benign
R7099:Syne1 UTSW 10 5123744 missense probably benign 0.43
R7107:Syne1 UTSW 10 5132078 missense probably damaging 1.00
R7120:Syne1 UTSW 10 5293971 missense probably benign
R7127:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7128:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7131:Syne1 UTSW 10 5228221 missense probably damaging 1.00
R7132:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7133:Syne1 UTSW 10 5231592 missense probably damaging 1.00
R7135:Syne1 UTSW 10 5233409 missense probably benign 0.01
R7147:Syne1 UTSW 10 5249340 missense probably damaging 1.00
R7158:Syne1 UTSW 10 5057931 missense probably damaging 1.00
R7189:Syne1 UTSW 10 5424295 missense probably benign 0.03
R7193:Syne1 UTSW 10 5233406 missense probably damaging 1.00
R7194:Syne1 UTSW 10 5110859 missense probably damaging 1.00
R7233:Syne1 UTSW 10 5302160 missense probably damaging 1.00
R7255:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7267:Syne1 UTSW 10 5228218 missense probably damaging 1.00
R7294:Syne1 UTSW 10 5097483 critical splice donor site probably null
R7303:Syne1 UTSW 10 5256805 missense probably benign 0.04
R7313:Syne1 UTSW 10 5047635 missense probably damaging 1.00
R7330:Syne1 UTSW 10 5128434 missense probably benign 0.00
R7334:Syne1 UTSW 10 5057886 missense probably damaging 1.00
R7363:Syne1 UTSW 10 5140970 missense possibly damaging 0.45
R7400:Syne1 UTSW 10 5218580 missense probably benign 0.12
R7425:Syne1 UTSW 10 5425760 missense probably damaging 1.00
R7427:Syne1 UTSW 10 5273718 missense probably damaging 0.98
R7446:Syne1 UTSW 10 5222266 missense probably benign 0.00
R7462:Syne1 UTSW 10 5052793 missense possibly damaging 0.87
R7502:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7525:Syne1 UTSW 10 5185559 critical splice acceptor site probably null
R7529:Syne1 UTSW 10 5424382 missense probably damaging 1.00
R7577:Syne1 UTSW 10 5124820 missense probably damaging 1.00
R7579:Syne1 UTSW 10 5349324 missense probably damaging 1.00
R7594:Syne1 UTSW 10 5215190 critical splice donor site probably null
R7646:Syne1 UTSW 10 5172949 missense probably damaging 1.00
R7651:Syne1 UTSW 10 5205074 missense probably benign 0.38
R7651:Syne1 UTSW 10 5343416 missense probably damaging 1.00
R7669:Syne1 UTSW 10 5061531 missense probably damaging 1.00
R7672:Syne1 UTSW 10 5218527 missense probably benign 0.02
R7682:Syne1 UTSW 10 5162461 missense probably benign
R7702:Syne1 UTSW 10 5245835 missense probably damaging 1.00
R7767:Syne1 UTSW 10 5333560 missense possibly damaging 0.60
R7767:Syne1 UTSW 10 5333632 missense possibly damaging 0.49
R7829:Syne1 UTSW 10 5342293 missense probably damaging 0.96
RF010:Syne1 UTSW 10 5246386 missense possibly damaging 0.89
RF015:Syne1 UTSW 10 5302248 missense probably benign 0.01
RF023:Syne1 UTSW 10 5255482 missense probably damaging 1.00
X0017:Syne1 UTSW 10 5346917 missense probably damaging 1.00
X0025:Syne1 UTSW 10 5358973 nonsense probably null
X0063:Syne1 UTSW 10 5052354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAACTGAACTGAGCCAGTCCAG -3'
(R):5'- GTTCCCAGGAAAGGCCATCTATGTG -3'

Sequencing Primer
(F):5'- CTTTTCCCAGGAAGTAAAGCTGC -3'
(R):5'- AGGAAAGGCCATCTATGTGATTGTC -3'
Posted On2014-04-13