Incidental Mutation 'R1531:Myh4'
ID 166227
Institutional Source Beutler Lab
Gene Symbol Myh4
Ensembl Gene ENSMUSG00000057003
Gene Name myosin, heavy polypeptide 4, skeletal muscle
Synonyms MYH-2B, MM, MHC2B, MyHC-IIb, Myhsf, Minimsc, Minmus
MMRRC Submission 039570-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.386) question?
Stock # R1531 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 67128855-67151272 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67141366 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 780 (M780V)
Ref Sequence ENSEMBL: ENSMUSP00000127514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018632] [ENSMUST00000170942]
AlphaFold Q5SX39
Predicted Effect probably benign
Transcript: ENSMUST00000018632
AA Change: M780V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000018632
Gene: ENSMUSG00000057003
AA Change: M780V

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 4.7e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
Pfam:Myosin_tail_1 847 1928 2.5e-168 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170942
AA Change: M780V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000127514
Gene: ENSMUSG00000057003
AA Change: M780V

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-15 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
low complexity region 928 942 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit decreased growth and muscle defects including reduced muscle mass, muscle fiber loss, compensatory fiber hypertrophy, and impaired strength. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T A 13: 59,648,448 (GRCm39) probably null Het
Aldh3b2 T G 19: 4,027,543 (GRCm39) F28C probably damaging Het
Apaf1 T C 10: 90,890,383 (GRCm39) N540S probably damaging Het
Apob T C 12: 8,047,880 (GRCm39) I953T possibly damaging Het
Arhgef1 A G 7: 24,624,423 (GRCm39) T816A probably damaging Het
Arid4a T A 12: 71,122,779 (GRCm39) F1053L probably benign Het
Atxn1l A C 8: 110,458,691 (GRCm39) F524V probably damaging Het
Cad T A 5: 31,233,563 (GRCm39) M1874K probably benign Het
Ccdc40 G A 11: 119,154,015 (GRCm39) V1096I probably benign Het
Ccdc93 A G 1: 121,408,551 (GRCm39) D358G probably benign Het
Cd96 T C 16: 45,938,169 (GRCm39) T99A probably benign Het
Cdc42ep3 A T 17: 79,642,473 (GRCm39) M149K probably benign Het
Cgas A G 9: 78,349,763 (GRCm39) Y200H probably damaging Het
Cog4 A G 8: 111,606,353 (GRCm39) E613G probably benign Het
Crebbp A T 16: 3,902,381 (GRCm39) I2286N probably benign Het
Csf1 T C 3: 107,655,654 (GRCm39) E459G possibly damaging Het
Csrp2 A T 10: 110,771,066 (GRCm39) Y57F probably benign Het
Ctdspl C T 9: 118,869,650 (GRCm39) P244L probably damaging Het
Cyp2c29 A G 19: 39,313,412 (GRCm39) R303G probably damaging Het
Cyp4a10 C A 4: 115,375,632 (GRCm39) Y38* probably null Het
Dmgdh T A 13: 93,880,919 (GRCm39) I783N probably damaging Het
Efcc1 G A 6: 87,708,148 (GRCm39) E92K probably benign Het
Eif2ak4 T A 2: 118,273,691 (GRCm39) L872H probably damaging Het
Elp2 T A 18: 24,764,461 (GRCm39) S603T probably benign Het
Eml2 T A 7: 18,930,179 (GRCm39) L300H probably damaging Het
Esp3 A G 17: 40,946,827 (GRCm39) K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 (GRCm39) F136L probably damaging Het
Exoc1 T A 5: 76,707,011 (GRCm39) D497E probably damaging Het
Fat3 A G 9: 15,908,761 (GRCm39) S2414P probably damaging Het
Foxj3 C T 4: 119,477,398 (GRCm39) P369S unknown Het
Gkn2 G T 6: 87,352,921 (GRCm39) probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,649,766 (GRCm39) noncoding transcript Het
Gm21905 A T 5: 68,103,724 (GRCm39) probably benign Het
Grhl1 T A 12: 24,632,962 (GRCm39) probably null Het
Grk6 A G 13: 55,599,967 (GRCm39) Y221C probably damaging Het
Hcrtr1 T A 4: 130,024,720 (GRCm39) K389* probably null Het
Hk1 G A 10: 62,120,563 (GRCm39) R545C probably damaging Het
Hsp90b1 A T 10: 86,532,659 (GRCm39) I339N probably benign Het
Ikzf3 T C 11: 98,381,272 (GRCm39) R103G probably damaging Het
Itgad A C 7: 127,777,542 (GRCm39) I141L probably benign Het
Jmjd6 T A 11: 116,733,266 (GRCm39) Y137F probably benign Het
Kcna1 A G 6: 126,619,030 (GRCm39) V430A probably benign Het
Kel A G 6: 41,665,560 (GRCm39) V520A probably damaging Het
Klhl41 G A 2: 69,501,084 (GRCm39) V182I probably benign Het
Ldhb C A 6: 142,447,121 (GRCm39) M64I probably benign Het
Lrrc23 A G 6: 124,753,077 (GRCm39) S190P possibly damaging Het
Mboat2 T C 12: 25,009,029 (GRCm39) V445A probably benign Het
Mlycd G A 8: 120,128,258 (GRCm39) W188* probably null Het
Mpp3 C T 11: 101,899,475 (GRCm39) E349K probably benign Het
Mtres1 A G 10: 43,401,316 (GRCm39) V211A probably benign Het
Myh6 G A 14: 55,193,963 (GRCm39) R809C probably damaging Het
Mylip G A 13: 45,560,046 (GRCm39) V161M possibly damaging Het
Nrp1 G A 8: 129,152,450 (GRCm39) V220I probably null Het
Nup210 A T 6: 91,011,823 (GRCm39) N455K probably benign Het
Or14j10 A T 17: 37,935,243 (GRCm39) Y94* probably null Het
Or51f1d C A 7: 102,700,795 (GRCm39) Q97K probably benign Het
Pbld2 G T 10: 62,889,732 (GRCm39) probably null Het
Pclo C G 5: 14,571,917 (GRCm39) P434R probably damaging Het
Pdlim3 A G 8: 46,349,800 (GRCm39) K37E probably damaging Het
Prkdc T A 16: 15,589,970 (GRCm39) I2611N probably benign Het
Prr12 T C 7: 44,677,954 (GRCm39) D2019G unknown Het
Rab27a A G 9: 73,002,685 (GRCm39) T205A probably benign Het
Rcan3 A G 4: 135,152,595 (GRCm39) L42P probably damaging Het
Rchy1 T C 5: 92,103,474 (GRCm39) probably null Het
Sema6a T C 18: 47,382,066 (GRCm39) H827R probably damaging Het
Sertad4 A G 1: 192,533,258 (GRCm39) probably null Het
Smarcd1 T A 15: 99,605,264 (GRCm39) C282S probably damaging Het
Speg A G 1: 75,377,866 (GRCm39) T769A possibly damaging Het
Syne1 T A 10: 5,297,875 (GRCm39) K1141* probably null Het
Synpo2 T C 3: 122,911,315 (GRCm39) E110G probably benign Het
Tg T A 15: 66,722,351 (GRCm39) D333E probably benign Het
Tmem132c A G 5: 127,436,955 (GRCm39) Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 (GRCm39) V14E probably damaging Het
Tmem229b A G 12: 79,011,685 (GRCm39) L82P probably damaging Het
Togaram1 A G 12: 65,013,039 (GRCm39) T97A probably benign Het
Trappc9 G A 15: 72,565,397 (GRCm39) R965* probably null Het
Trio T C 15: 27,833,071 (GRCm39) I104V probably benign Het
Trp73 A G 4: 154,148,352 (GRCm39) F354S probably benign Het
Ttyh2 T C 11: 114,577,278 (GRCm39) L63P probably damaging Het
Ulk4 G C 9: 120,873,841 (GRCm39) P1197A probably damaging Het
Vmn1r176 T C 7: 23,534,536 (GRCm39) M206V possibly damaging Het
Vps8 T A 16: 21,285,226 (GRCm39) Y402* probably null Het
Zbtb41 A G 1: 139,350,931 (GRCm39) I15V probably benign Het
Zc3hav1 T C 6: 38,284,170 (GRCm39) I982V possibly damaging Het
Zmynd19 T A 2: 24,848,123 (GRCm39) N106K probably benign Het
Other mutations in Myh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Myh4 APN 11 67,146,205 (GRCm39) missense probably damaging 1.00
IGL01600:Myh4 APN 11 67,151,015 (GRCm39) missense possibly damaging 0.85
IGL01737:Myh4 APN 11 67,134,245 (GRCm39) splice site probably benign
IGL02208:Myh4 APN 11 67,142,760 (GRCm39) missense possibly damaging 0.96
IGL02334:Myh4 APN 11 67,136,373 (GRCm39) missense probably damaging 1.00
IGL02376:Myh4 APN 11 67,136,554 (GRCm39) missense probably benign 0.00
IGL02429:Myh4 APN 11 67,149,808 (GRCm39) nonsense probably null
IGL02450:Myh4 APN 11 67,142,635 (GRCm39) missense probably damaging 1.00
IGL02524:Myh4 APN 11 67,140,066 (GRCm39) missense possibly damaging 0.79
IGL02612:Myh4 APN 11 67,147,305 (GRCm39) missense probably benign
IGL03024:Myh4 APN 11 67,139,305 (GRCm39) missense probably damaging 1.00
IGL03065:Myh4 APN 11 67,149,982 (GRCm39) missense probably benign 0.12
IGL03084:Myh4 APN 11 67,142,777 (GRCm39) splice site probably null
IGL03188:Myh4 APN 11 67,137,369 (GRCm39) critical splice donor site probably null
IGL03204:Myh4 APN 11 67,141,122 (GRCm39) missense possibly damaging 0.63
IGL03252:Myh4 APN 11 67,143,042 (GRCm39) missense probably damaging 0.99
IGL03345:Myh4 APN 11 67,146,304 (GRCm39) missense probably damaging 1.00
Mr_chicken UTSW 11 67,140,711 (GRCm39) missense possibly damaging 0.74
Mrs_muir UTSW 11 67,136,339 (GRCm39) missense probably damaging 1.00
Willies UTSW 11 67,132,335 (GRCm39) missense probably damaging 1.00
F6893:Myh4 UTSW 11 67,146,283 (GRCm39) missense probably null 0.12
PIT1430001:Myh4 UTSW 11 67,149,658 (GRCm39) missense probably benign 0.01
PIT4458001:Myh4 UTSW 11 67,131,821 (GRCm39) missense possibly damaging 0.56
R0099:Myh4 UTSW 11 67,150,173 (GRCm39) missense probably benign
R0194:Myh4 UTSW 11 67,143,162 (GRCm39) missense probably damaging 1.00
R0346:Myh4 UTSW 11 67,151,152 (GRCm39) missense probably benign
R0427:Myh4 UTSW 11 67,149,479 (GRCm39) missense probably damaging 0.98
R0483:Myh4 UTSW 11 67,143,123 (GRCm39) missense probably damaging 1.00
R0571:Myh4 UTSW 11 67,141,157 (GRCm39) missense possibly damaging 0.91
R0854:Myh4 UTSW 11 67,149,973 (GRCm39) missense possibly damaging 0.90
R0940:Myh4 UTSW 11 67,133,689 (GRCm39) missense probably damaging 1.00
R0946:Myh4 UTSW 11 67,142,577 (GRCm39) missense possibly damaging 0.70
R1108:Myh4 UTSW 11 67,146,532 (GRCm39) missense probably null 0.01
R1162:Myh4 UTSW 11 67,149,439 (GRCm39) missense probably damaging 0.97
R1194:Myh4 UTSW 11 67,146,560 (GRCm39) critical splice donor site probably null
R1347:Myh4 UTSW 11 67,135,567 (GRCm39) splice site probably benign
R1457:Myh4 UTSW 11 67,139,287 (GRCm39) missense probably damaging 0.99
R1716:Myh4 UTSW 11 67,141,135 (GRCm39) missense possibly damaging 0.92
R1766:Myh4 UTSW 11 67,147,121 (GRCm39) missense possibly damaging 0.61
R1796:Myh4 UTSW 11 67,151,150 (GRCm39) missense probably benign
R1856:Myh4 UTSW 11 67,146,508 (GRCm39) missense probably damaging 1.00
R1873:Myh4 UTSW 11 67,145,569 (GRCm39) missense probably benign 0.16
R2069:Myh4 UTSW 11 67,137,192 (GRCm39) splice site probably benign
R2370:Myh4 UTSW 11 67,146,454 (GRCm39) missense probably damaging 1.00
R2406:Myh4 UTSW 11 67,150,000 (GRCm39) missense probably damaging 1.00
R2414:Myh4 UTSW 11 67,141,594 (GRCm39) missense probably benign 0.01
R2848:Myh4 UTSW 11 67,139,459 (GRCm39) missense probably benign 0.20
R3111:Myh4 UTSW 11 67,137,276 (GRCm39) missense possibly damaging 0.86
R3744:Myh4 UTSW 11 67,146,141 (GRCm39) missense probably damaging 1.00
R3845:Myh4 UTSW 11 67,149,931 (GRCm39) missense possibly damaging 0.90
R3877:Myh4 UTSW 11 67,148,009 (GRCm39) missense probably benign 0.00
R4498:Myh4 UTSW 11 67,142,578 (GRCm39) missense probably damaging 1.00
R4514:Myh4 UTSW 11 67,146,395 (GRCm39) missense probably benign 0.06
R4601:Myh4 UTSW 11 67,141,136 (GRCm39) missense possibly damaging 0.94
R4673:Myh4 UTSW 11 67,137,227 (GRCm39) missense probably benign 0.02
R4684:Myh4 UTSW 11 67,136,637 (GRCm39) missense probably damaging 0.99
R4736:Myh4 UTSW 11 67,131,746 (GRCm39) missense probably benign 0.01
R4837:Myh4 UTSW 11 67,149,818 (GRCm39) missense probably benign 0.38
R4866:Myh4 UTSW 11 67,139,453 (GRCm39) missense probably benign 0.00
R4869:Myh4 UTSW 11 67,143,490 (GRCm39) missense probably damaging 1.00
R4887:Myh4 UTSW 11 67,131,880 (GRCm39) missense probably damaging 0.99
R4921:Myh4 UTSW 11 67,144,854 (GRCm39) missense probably damaging 1.00
R5005:Myh4 UTSW 11 67,144,241 (GRCm39) missense probably benign 0.05
R5008:Myh4 UTSW 11 67,144,358 (GRCm39) missense probably benign 0.00
R5011:Myh4 UTSW 11 67,147,189 (GRCm39) missense probably benign 0.03
R5087:Myh4 UTSW 11 67,146,235 (GRCm39) missense probably damaging 1.00
R5277:Myh4 UTSW 11 67,143,180 (GRCm39) missense probably damaging 1.00
R5336:Myh4 UTSW 11 67,150,017 (GRCm39) splice site probably null
R5354:Myh4 UTSW 11 67,146,551 (GRCm39) missense possibly damaging 0.69
R5371:Myh4 UTSW 11 67,150,150 (GRCm39) missense probably damaging 1.00
R5484:Myh4 UTSW 11 67,142,644 (GRCm39) missense probably damaging 1.00
R5774:Myh4 UTSW 11 67,144,034 (GRCm39) nonsense probably null
R5902:Myh4 UTSW 11 67,141,733 (GRCm39) missense possibly damaging 0.69
R5941:Myh4 UTSW 11 67,150,126 (GRCm39) missense probably damaging 0.99
R6045:Myh4 UTSW 11 67,135,550 (GRCm39) missense probably benign 0.32
R6156:Myh4 UTSW 11 67,141,618 (GRCm39) missense probably benign 0.00
R6301:Myh4 UTSW 11 67,146,159 (GRCm39) missense possibly damaging 0.95
R6318:Myh4 UTSW 11 67,134,268 (GRCm39) missense probably benign 0.02
R6352:Myh4 UTSW 11 67,143,108 (GRCm39) missense probably damaging 1.00
R6385:Myh4 UTSW 11 67,146,663 (GRCm39) missense probably damaging 1.00
R6493:Myh4 UTSW 11 67,149,455 (GRCm39) missense probably benign 0.16
R6666:Myh4 UTSW 11 67,142,638 (GRCm39) missense probably damaging 1.00
R6826:Myh4 UTSW 11 67,137,357 (GRCm39) missense probably damaging 1.00
R6852:Myh4 UTSW 11 67,143,794 (GRCm39) splice site probably null
R6857:Myh4 UTSW 11 67,140,711 (GRCm39) missense possibly damaging 0.74
R7029:Myh4 UTSW 11 67,137,251 (GRCm39) missense probably benign 0.40
R7076:Myh4 UTSW 11 67,143,999 (GRCm39) missense possibly damaging 0.85
R7145:Myh4 UTSW 11 67,151,054 (GRCm39) missense possibly damaging 0.54
R7179:Myh4 UTSW 11 67,135,550 (GRCm39) missense probably benign 0.32
R7365:Myh4 UTSW 11 67,133,674 (GRCm39) missense probably damaging 1.00
R7514:Myh4 UTSW 11 67,134,148 (GRCm39) critical splice donor site probably null
R7553:Myh4 UTSW 11 67,147,221 (GRCm39) missense probably damaging 0.99
R7666:Myh4 UTSW 11 67,147,107 (GRCm39) missense probably damaging 0.99
R7673:Myh4 UTSW 11 67,136,339 (GRCm39) missense probably damaging 1.00
R7685:Myh4 UTSW 11 67,131,756 (GRCm39) missense probably benign 0.13
R8154:Myh4 UTSW 11 67,144,200 (GRCm39) missense probably damaging 1.00
R8343:Myh4 UTSW 11 67,143,390 (GRCm39) missense possibly damaging 0.45
R8446:Myh4 UTSW 11 67,144,347 (GRCm39) missense probably benign 0.14
R8534:Myh4 UTSW 11 67,134,335 (GRCm39) missense probably benign 0.17
R8710:Myh4 UTSW 11 67,143,158 (GRCm39) missense probably benign
R8775:Myh4 UTSW 11 67,148,006 (GRCm39) missense probably benign 0.25
R8775-TAIL:Myh4 UTSW 11 67,148,006 (GRCm39) missense probably benign 0.25
R8852:Myh4 UTSW 11 67,132,335 (GRCm39) missense probably damaging 1.00
R8860:Myh4 UTSW 11 67,132,335 (GRCm39) missense probably damaging 1.00
R8897:Myh4 UTSW 11 67,137,362 (GRCm39) missense possibly damaging 0.90
R8954:Myh4 UTSW 11 67,143,806 (GRCm39) missense possibly damaging 0.95
R8957:Myh4 UTSW 11 67,141,780 (GRCm39) missense possibly damaging 0.78
R9065:Myh4 UTSW 11 67,139,573 (GRCm39) missense probably benign
R9280:Myh4 UTSW 11 67,146,135 (GRCm39) missense probably damaging 0.96
R9296:Myh4 UTSW 11 67,146,130 (GRCm39) missense possibly damaging 0.95
R9310:Myh4 UTSW 11 67,145,570 (GRCm39) missense probably damaging 1.00
R9314:Myh4 UTSW 11 67,151,141 (GRCm39) missense probably benign 0.01
R9462:Myh4 UTSW 11 67,141,811 (GRCm39) missense possibly damaging 0.93
R9516:Myh4 UTSW 11 67,141,129 (GRCm39) missense probably damaging 1.00
R9516:Myh4 UTSW 11 67,139,290 (GRCm39) missense probably damaging 0.99
R9773:Myh4 UTSW 11 67,137,263 (GRCm39) missense probably damaging 1.00
X0027:Myh4 UTSW 11 67,137,306 (GRCm39) missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67,147,097 (GRCm39) missense probably benign 0.02
Z1176:Myh4 UTSW 11 67,144,331 (GRCm39) missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67,139,467 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGAATGCAAGTGCCATCCC -3'
(R):5'- CGTGCTCTGGATTCCGAGATGAAAG -3'

Sequencing Primer
(F):5'- GAGAAACTTCTGGGTTCCATTGAC -3'
(R):5'- CTGGATTCCGAGATGAAAGAGGTAG -3'
Posted On 2014-04-13