Incidental Mutation 'R1531:Mpp3'
ID 166229
Institutional Source Beutler Lab
Gene Symbol Mpp3
Ensembl Gene ENSMUSG00000052373
Gene Name membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Synonyms Dlgh3
MMRRC Submission 039570-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1531 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 101890478-101919287 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 101899475 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 349 (E349K)
Ref Sequence ENSEMBL: ENSMUSP00000102786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062801] [ENSMUST00000100400] [ENSMUST00000107168]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062801
AA Change: E349K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055469
Gene: ENSMUSG00000052373
AA Change: E349K

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100400
AA Change: E349K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097969
Gene: ENSMUSG00000052373
AA Change: E349K

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107168
AA Change: E349K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102786
Gene: ENSMUSG00000052373
AA Change: E349K

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132094
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologs). MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intracellular junctions. This protein contains a conserved sequence, called the SH3 (src homology 3) motif, found in several other proteins that associate with the cytoskeleton and are suspected to play important roles in signal transduction. Alternatively spliced transcript variants have been identified. One transcript variant is experimentally supported, but it doesn't encode a protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T A 13: 59,648,448 (GRCm39) probably null Het
Aldh3b2 T G 19: 4,027,543 (GRCm39) F28C probably damaging Het
Apaf1 T C 10: 90,890,383 (GRCm39) N540S probably damaging Het
Apob T C 12: 8,047,880 (GRCm39) I953T possibly damaging Het
Arhgef1 A G 7: 24,624,423 (GRCm39) T816A probably damaging Het
Arid4a T A 12: 71,122,779 (GRCm39) F1053L probably benign Het
Atxn1l A C 8: 110,458,691 (GRCm39) F524V probably damaging Het
Cad T A 5: 31,233,563 (GRCm39) M1874K probably benign Het
Ccdc40 G A 11: 119,154,015 (GRCm39) V1096I probably benign Het
Ccdc93 A G 1: 121,408,551 (GRCm39) D358G probably benign Het
Cd96 T C 16: 45,938,169 (GRCm39) T99A probably benign Het
Cdc42ep3 A T 17: 79,642,473 (GRCm39) M149K probably benign Het
Cgas A G 9: 78,349,763 (GRCm39) Y200H probably damaging Het
Cog4 A G 8: 111,606,353 (GRCm39) E613G probably benign Het
Crebbp A T 16: 3,902,381 (GRCm39) I2286N probably benign Het
Csf1 T C 3: 107,655,654 (GRCm39) E459G possibly damaging Het
Csrp2 A T 10: 110,771,066 (GRCm39) Y57F probably benign Het
Ctdspl C T 9: 118,869,650 (GRCm39) P244L probably damaging Het
Cyp2c29 A G 19: 39,313,412 (GRCm39) R303G probably damaging Het
Cyp4a10 C A 4: 115,375,632 (GRCm39) Y38* probably null Het
Dmgdh T A 13: 93,880,919 (GRCm39) I783N probably damaging Het
Efcc1 G A 6: 87,708,148 (GRCm39) E92K probably benign Het
Eif2ak4 T A 2: 118,273,691 (GRCm39) L872H probably damaging Het
Elp2 T A 18: 24,764,461 (GRCm39) S603T probably benign Het
Eml2 T A 7: 18,930,179 (GRCm39) L300H probably damaging Het
Esp3 A G 17: 40,946,827 (GRCm39) K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 (GRCm39) F136L probably damaging Het
Exoc1 T A 5: 76,707,011 (GRCm39) D497E probably damaging Het
Fat3 A G 9: 15,908,761 (GRCm39) S2414P probably damaging Het
Foxj3 C T 4: 119,477,398 (GRCm39) P369S unknown Het
Gkn2 G T 6: 87,352,921 (GRCm39) probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,649,766 (GRCm39) noncoding transcript Het
Gm21905 A T 5: 68,103,724 (GRCm39) probably benign Het
Grhl1 T A 12: 24,632,962 (GRCm39) probably null Het
Grk6 A G 13: 55,599,967 (GRCm39) Y221C probably damaging Het
Hcrtr1 T A 4: 130,024,720 (GRCm39) K389* probably null Het
Hk1 G A 10: 62,120,563 (GRCm39) R545C probably damaging Het
Hsp90b1 A T 10: 86,532,659 (GRCm39) I339N probably benign Het
Ikzf3 T C 11: 98,381,272 (GRCm39) R103G probably damaging Het
Itgad A C 7: 127,777,542 (GRCm39) I141L probably benign Het
Jmjd6 T A 11: 116,733,266 (GRCm39) Y137F probably benign Het
Kcna1 A G 6: 126,619,030 (GRCm39) V430A probably benign Het
Kel A G 6: 41,665,560 (GRCm39) V520A probably damaging Het
Klhl41 G A 2: 69,501,084 (GRCm39) V182I probably benign Het
Ldhb C A 6: 142,447,121 (GRCm39) M64I probably benign Het
Lrrc23 A G 6: 124,753,077 (GRCm39) S190P possibly damaging Het
Mboat2 T C 12: 25,009,029 (GRCm39) V445A probably benign Het
Mlycd G A 8: 120,128,258 (GRCm39) W188* probably null Het
Mtres1 A G 10: 43,401,316 (GRCm39) V211A probably benign Het
Myh4 A G 11: 67,141,366 (GRCm39) M780V probably benign Het
Myh6 G A 14: 55,193,963 (GRCm39) R809C probably damaging Het
Mylip G A 13: 45,560,046 (GRCm39) V161M possibly damaging Het
Nrp1 G A 8: 129,152,450 (GRCm39) V220I probably null Het
Nup210 A T 6: 91,011,823 (GRCm39) N455K probably benign Het
Or14j10 A T 17: 37,935,243 (GRCm39) Y94* probably null Het
Or51f1d C A 7: 102,700,795 (GRCm39) Q97K probably benign Het
Pbld2 G T 10: 62,889,732 (GRCm39) probably null Het
Pclo C G 5: 14,571,917 (GRCm39) P434R probably damaging Het
Pdlim3 A G 8: 46,349,800 (GRCm39) K37E probably damaging Het
Prkdc T A 16: 15,589,970 (GRCm39) I2611N probably benign Het
Prr12 T C 7: 44,677,954 (GRCm39) D2019G unknown Het
Rab27a A G 9: 73,002,685 (GRCm39) T205A probably benign Het
Rcan3 A G 4: 135,152,595 (GRCm39) L42P probably damaging Het
Rchy1 T C 5: 92,103,474 (GRCm39) probably null Het
Sema6a T C 18: 47,382,066 (GRCm39) H827R probably damaging Het
Sertad4 A G 1: 192,533,258 (GRCm39) probably null Het
Smarcd1 T A 15: 99,605,264 (GRCm39) C282S probably damaging Het
Speg A G 1: 75,377,866 (GRCm39) T769A possibly damaging Het
Syne1 T A 10: 5,297,875 (GRCm39) K1141* probably null Het
Synpo2 T C 3: 122,911,315 (GRCm39) E110G probably benign Het
Tg T A 15: 66,722,351 (GRCm39) D333E probably benign Het
Tmem132c A G 5: 127,436,955 (GRCm39) Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 (GRCm39) V14E probably damaging Het
Tmem229b A G 12: 79,011,685 (GRCm39) L82P probably damaging Het
Togaram1 A G 12: 65,013,039 (GRCm39) T97A probably benign Het
Trappc9 G A 15: 72,565,397 (GRCm39) R965* probably null Het
Trio T C 15: 27,833,071 (GRCm39) I104V probably benign Het
Trp73 A G 4: 154,148,352 (GRCm39) F354S probably benign Het
Ttyh2 T C 11: 114,577,278 (GRCm39) L63P probably damaging Het
Ulk4 G C 9: 120,873,841 (GRCm39) P1197A probably damaging Het
Vmn1r176 T C 7: 23,534,536 (GRCm39) M206V possibly damaging Het
Vps8 T A 16: 21,285,226 (GRCm39) Y402* probably null Het
Zbtb41 A G 1: 139,350,931 (GRCm39) I15V probably benign Het
Zc3hav1 T C 6: 38,284,170 (GRCm39) I982V possibly damaging Het
Zmynd19 T A 2: 24,848,123 (GRCm39) N106K probably benign Het
Other mutations in Mpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Mpp3 APN 11 101,892,929 (GRCm39) missense possibly damaging 0.76
IGL01337:Mpp3 APN 11 101,891,411 (GRCm39) missense probably benign
IGL01393:Mpp3 APN 11 101,916,304 (GRCm39) missense probably damaging 0.99
IGL01544:Mpp3 APN 11 101,909,485 (GRCm39) missense possibly damaging 0.91
IGL02152:Mpp3 APN 11 101,916,216 (GRCm39) nonsense probably null
IGL02441:Mpp3 APN 11 101,900,501 (GRCm39) missense probably benign 0.00
IGL02656:Mpp3 APN 11 101,899,427 (GRCm39) missense probably benign
R0013:Mpp3 UTSW 11 101,896,251 (GRCm39) missense probably benign 0.27
R0117:Mpp3 UTSW 11 101,891,399 (GRCm39) missense probably damaging 1.00
R0564:Mpp3 UTSW 11 101,896,173 (GRCm39) missense possibly damaging 0.87
R1372:Mpp3 UTSW 11 101,891,401 (GRCm39) missense probably damaging 0.96
R1639:Mpp3 UTSW 11 101,914,268 (GRCm39) missense probably damaging 1.00
R1720:Mpp3 UTSW 11 101,916,582 (GRCm39) start codon destroyed possibly damaging 0.79
R1968:Mpp3 UTSW 11 101,909,378 (GRCm39) intron probably benign
R2064:Mpp3 UTSW 11 101,891,516 (GRCm39) missense probably benign 0.01
R2363:Mpp3 UTSW 11 101,911,312 (GRCm39) missense probably damaging 1.00
R3775:Mpp3 UTSW 11 101,914,193 (GRCm39) nonsense probably null
R3776:Mpp3 UTSW 11 101,914,193 (GRCm39) nonsense probably null
R4208:Mpp3 UTSW 11 101,891,426 (GRCm39) missense probably benign
R4287:Mpp3 UTSW 11 101,914,289 (GRCm39) missense probably damaging 1.00
R4327:Mpp3 UTSW 11 101,914,337 (GRCm39) intron probably benign
R4329:Mpp3 UTSW 11 101,914,337 (GRCm39) intron probably benign
R4367:Mpp3 UTSW 11 101,914,246 (GRCm39) missense probably benign 0.01
R4856:Mpp3 UTSW 11 101,915,962 (GRCm39) missense probably benign
R4886:Mpp3 UTSW 11 101,915,962 (GRCm39) missense probably benign
R4904:Mpp3 UTSW 11 101,891,413 (GRCm39) missense probably benign 0.01
R4946:Mpp3 UTSW 11 101,895,848 (GRCm39) missense probably benign 0.01
R5405:Mpp3 UTSW 11 101,901,047 (GRCm39) missense probably benign
R5935:Mpp3 UTSW 11 101,916,241 (GRCm39) missense probably damaging 1.00
R6020:Mpp3 UTSW 11 101,909,365 (GRCm39) intron probably benign
R6056:Mpp3 UTSW 11 101,902,515 (GRCm39) splice site probably null
R6151:Mpp3 UTSW 11 101,899,392 (GRCm39) missense probably benign 0.11
R6677:Mpp3 UTSW 11 101,899,444 (GRCm39) missense probably benign
R6784:Mpp3 UTSW 11 101,892,974 (GRCm39) critical splice acceptor site probably null
R6855:Mpp3 UTSW 11 101,904,151 (GRCm39) missense probably benign 0.09
R7227:Mpp3 UTSW 11 101,895,904 (GRCm39) missense possibly damaging 0.90
R7635:Mpp3 UTSW 11 101,916,209 (GRCm39) missense probably damaging 0.97
R7974:Mpp3 UTSW 11 101,899,180 (GRCm39) critical splice donor site probably null
R8330:Mpp3 UTSW 11 101,899,453 (GRCm39) missense probably benign 0.20
R8331:Mpp3 UTSW 11 101,902,541 (GRCm39) splice site probably null
R8993:Mpp3 UTSW 11 101,891,491 (GRCm39) missense probably benign 0.03
R9154:Mpp3 UTSW 11 101,911,328 (GRCm39) missense
R9593:Mpp3 UTSW 11 101,907,506 (GRCm39) missense possibly damaging 0.88
R9655:Mpp3 UTSW 11 101,899,481 (GRCm39) missense probably benign
Z1176:Mpp3 UTSW 11 101,899,182 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGAACTCCTGAGGAAGCCAGAC -3'
(R):5'- ATCCAGCCTGGAACAATCCACTTG -3'

Sequencing Primer
(F):5'- GACCACCTAGAAACTCAGGATG -3'
(R):5'- gcacacgccaaggaaaac -3'
Posted On 2014-04-13