Incidental Mutation 'R1531:Ccdc40'
ID 166233
Institutional Source Beutler Lab
Gene Symbol Ccdc40
Ensembl Gene ENSMUSG00000039963
Gene Name coiled-coil domain containing 40
Synonyms B930008I02Rik
MMRRC Submission 039570-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.174) question?
Stock # R1531 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 119119398-119156064 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 119154015 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1096 (V1096I)
Ref Sequence ENSEMBL: ENSMUSP00000039463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000035935] [ENSMUST00000053440] [ENSMUST00000106258] [ENSMUST00000106259]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026666
SMART Domains Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:Gal_mutarotas_2 254 320 3.7e-12 PFAM
Pfam:Glyco_hydro_31 340 825 8.8e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035935
AA Change: V1096I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000039463
Gene: ENSMUSG00000039963
AA Change: V1096I

DomainStartEndE-ValueType
internal_repeat_1 7 48 1.25e-8 PROSPERO
internal_repeat_1 55 96 1.25e-8 PROSPERO
low complexity region 159 170 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
coiled coil region 349 371 N/A INTRINSIC
coiled coil region 423 447 N/A INTRINSIC
Blast:HisKA 450 519 3e-13 BLAST
Blast:HisKA 574 629 5e-8 BLAST
low complexity region 793 805 N/A INTRINSIC
Pfam:BRE1 830 928 4.2e-20 PFAM
coiled coil region 1044 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053440
SMART Domains Protein: ENSMUSP00000062198
Gene: ENSMUSG00000039963

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
internal_repeat_1 79 114 5.57e-8 PROSPERO
internal_repeat_1 111 150 5.57e-8 PROSPERO
low complexity region 229 240 N/A INTRINSIC
low complexity region 278 302 N/A INTRINSIC
coiled coil region 419 441 N/A INTRINSIC
coiled coil region 493 517 N/A INTRINSIC
Blast:HisKA 520 589 2e-13 BLAST
Blast:HisKA 644 699 4e-8 BLAST
low complexity region 863 875 N/A INTRINSIC
Pfam:BRE1 900 998 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106258
SMART Domains Protein: ENSMUSP00000101865
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106259
SMART Domains Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:NtCtMGAM_N 147 253 3.5e-32 PFAM
Pfam:Gal_mutarotas_2 254 320 6.5e-12 PFAM
Pfam:Glyco_hydro_31 340 825 1.8e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155683
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is necessary for motile cilia function. It functions in correct left-right axis formation by regulating the assembly of the inner dynein arm and the dynein regulatory complexes, which control ciliary beat. Mutations in this gene cause ciliary dyskinesia type 15, a disorder due to defects in cilia motility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit heterotaxia, hydrocephalus, short embryonic cilia, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T A 13: 59,648,448 (GRCm39) probably null Het
Aldh3b2 T G 19: 4,027,543 (GRCm39) F28C probably damaging Het
Apaf1 T C 10: 90,890,383 (GRCm39) N540S probably damaging Het
Apob T C 12: 8,047,880 (GRCm39) I953T possibly damaging Het
Arhgef1 A G 7: 24,624,423 (GRCm39) T816A probably damaging Het
Arid4a T A 12: 71,122,779 (GRCm39) F1053L probably benign Het
Atxn1l A C 8: 110,458,691 (GRCm39) F524V probably damaging Het
Cad T A 5: 31,233,563 (GRCm39) M1874K probably benign Het
Ccdc93 A G 1: 121,408,551 (GRCm39) D358G probably benign Het
Cd96 T C 16: 45,938,169 (GRCm39) T99A probably benign Het
Cdc42ep3 A T 17: 79,642,473 (GRCm39) M149K probably benign Het
Cgas A G 9: 78,349,763 (GRCm39) Y200H probably damaging Het
Cog4 A G 8: 111,606,353 (GRCm39) E613G probably benign Het
Crebbp A T 16: 3,902,381 (GRCm39) I2286N probably benign Het
Csf1 T C 3: 107,655,654 (GRCm39) E459G possibly damaging Het
Csrp2 A T 10: 110,771,066 (GRCm39) Y57F probably benign Het
Ctdspl C T 9: 118,869,650 (GRCm39) P244L probably damaging Het
Cyp2c29 A G 19: 39,313,412 (GRCm39) R303G probably damaging Het
Cyp4a10 C A 4: 115,375,632 (GRCm39) Y38* probably null Het
Dmgdh T A 13: 93,880,919 (GRCm39) I783N probably damaging Het
Efcc1 G A 6: 87,708,148 (GRCm39) E92K probably benign Het
Eif2ak4 T A 2: 118,273,691 (GRCm39) L872H probably damaging Het
Elp2 T A 18: 24,764,461 (GRCm39) S603T probably benign Het
Eml2 T A 7: 18,930,179 (GRCm39) L300H probably damaging Het
Esp3 A G 17: 40,946,827 (GRCm39) K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 (GRCm39) F136L probably damaging Het
Exoc1 T A 5: 76,707,011 (GRCm39) D497E probably damaging Het
Fat3 A G 9: 15,908,761 (GRCm39) S2414P probably damaging Het
Foxj3 C T 4: 119,477,398 (GRCm39) P369S unknown Het
Gkn2 G T 6: 87,352,921 (GRCm39) probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,649,766 (GRCm39) noncoding transcript Het
Gm21905 A T 5: 68,103,724 (GRCm39) probably benign Het
Grhl1 T A 12: 24,632,962 (GRCm39) probably null Het
Grk6 A G 13: 55,599,967 (GRCm39) Y221C probably damaging Het
Hcrtr1 T A 4: 130,024,720 (GRCm39) K389* probably null Het
Hk1 G A 10: 62,120,563 (GRCm39) R545C probably damaging Het
Hsp90b1 A T 10: 86,532,659 (GRCm39) I339N probably benign Het
Ikzf3 T C 11: 98,381,272 (GRCm39) R103G probably damaging Het
Itgad A C 7: 127,777,542 (GRCm39) I141L probably benign Het
Jmjd6 T A 11: 116,733,266 (GRCm39) Y137F probably benign Het
Kcna1 A G 6: 126,619,030 (GRCm39) V430A probably benign Het
Kel A G 6: 41,665,560 (GRCm39) V520A probably damaging Het
Klhl41 G A 2: 69,501,084 (GRCm39) V182I probably benign Het
Ldhb C A 6: 142,447,121 (GRCm39) M64I probably benign Het
Lrrc23 A G 6: 124,753,077 (GRCm39) S190P possibly damaging Het
Mboat2 T C 12: 25,009,029 (GRCm39) V445A probably benign Het
Mlycd G A 8: 120,128,258 (GRCm39) W188* probably null Het
Mpp3 C T 11: 101,899,475 (GRCm39) E349K probably benign Het
Mtres1 A G 10: 43,401,316 (GRCm39) V211A probably benign Het
Myh4 A G 11: 67,141,366 (GRCm39) M780V probably benign Het
Myh6 G A 14: 55,193,963 (GRCm39) R809C probably damaging Het
Mylip G A 13: 45,560,046 (GRCm39) V161M possibly damaging Het
Nrp1 G A 8: 129,152,450 (GRCm39) V220I probably null Het
Nup210 A T 6: 91,011,823 (GRCm39) N455K probably benign Het
Or14j10 A T 17: 37,935,243 (GRCm39) Y94* probably null Het
Or51f1d C A 7: 102,700,795 (GRCm39) Q97K probably benign Het
Pbld2 G T 10: 62,889,732 (GRCm39) probably null Het
Pclo C G 5: 14,571,917 (GRCm39) P434R probably damaging Het
Pdlim3 A G 8: 46,349,800 (GRCm39) K37E probably damaging Het
Prkdc T A 16: 15,589,970 (GRCm39) I2611N probably benign Het
Prr12 T C 7: 44,677,954 (GRCm39) D2019G unknown Het
Rab27a A G 9: 73,002,685 (GRCm39) T205A probably benign Het
Rcan3 A G 4: 135,152,595 (GRCm39) L42P probably damaging Het
Rchy1 T C 5: 92,103,474 (GRCm39) probably null Het
Sema6a T C 18: 47,382,066 (GRCm39) H827R probably damaging Het
Sertad4 A G 1: 192,533,258 (GRCm39) probably null Het
Smarcd1 T A 15: 99,605,264 (GRCm39) C282S probably damaging Het
Speg A G 1: 75,377,866 (GRCm39) T769A possibly damaging Het
Syne1 T A 10: 5,297,875 (GRCm39) K1141* probably null Het
Synpo2 T C 3: 122,911,315 (GRCm39) E110G probably benign Het
Tg T A 15: 66,722,351 (GRCm39) D333E probably benign Het
Tmem132c A G 5: 127,436,955 (GRCm39) Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 (GRCm39) V14E probably damaging Het
Tmem229b A G 12: 79,011,685 (GRCm39) L82P probably damaging Het
Togaram1 A G 12: 65,013,039 (GRCm39) T97A probably benign Het
Trappc9 G A 15: 72,565,397 (GRCm39) R965* probably null Het
Trio T C 15: 27,833,071 (GRCm39) I104V probably benign Het
Trp73 A G 4: 154,148,352 (GRCm39) F354S probably benign Het
Ttyh2 T C 11: 114,577,278 (GRCm39) L63P probably damaging Het
Ulk4 G C 9: 120,873,841 (GRCm39) P1197A probably damaging Het
Vmn1r176 T C 7: 23,534,536 (GRCm39) M206V possibly damaging Het
Vps8 T A 16: 21,285,226 (GRCm39) Y402* probably null Het
Zbtb41 A G 1: 139,350,931 (GRCm39) I15V probably benign Het
Zc3hav1 T C 6: 38,284,170 (GRCm39) I982V possibly damaging Het
Zmynd19 T A 2: 24,848,123 (GRCm39) N106K probably benign Het
Other mutations in Ccdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Ccdc40 APN 11 119,133,545 (GRCm39) missense possibly damaging 0.90
IGL01864:Ccdc40 APN 11 119,133,911 (GRCm39) missense probably benign 0.23
IGL01911:Ccdc40 APN 11 119,122,797 (GRCm39) splice site probably null
IGL02640:Ccdc40 APN 11 119,128,904 (GRCm39) missense probably benign 0.18
IGL03278:Ccdc40 APN 11 119,133,336 (GRCm39) missense probably damaging 1.00
IGL03054:Ccdc40 UTSW 11 119,154,027 (GRCm39) missense possibly damaging 0.69
PIT4151001:Ccdc40 UTSW 11 119,133,277 (GRCm39) missense probably damaging 1.00
R0139:Ccdc40 UTSW 11 119,155,125 (GRCm39) missense probably benign 0.00
R0140:Ccdc40 UTSW 11 119,155,125 (GRCm39) missense probably benign 0.00
R0415:Ccdc40 UTSW 11 119,122,944 (GRCm39) missense possibly damaging 0.92
R0617:Ccdc40 UTSW 11 119,133,630 (GRCm39) missense probably damaging 1.00
R1396:Ccdc40 UTSW 11 119,122,629 (GRCm39) missense possibly damaging 0.66
R1751:Ccdc40 UTSW 11 119,121,522 (GRCm39) critical splice donor site probably null
R1767:Ccdc40 UTSW 11 119,121,522 (GRCm39) critical splice donor site probably null
R1870:Ccdc40 UTSW 11 119,150,730 (GRCm39) missense possibly damaging 0.81
R1971:Ccdc40 UTSW 11 119,153,901 (GRCm39) splice site probably null
R2106:Ccdc40 UTSW 11 119,155,123 (GRCm39) missense probably damaging 1.00
R2370:Ccdc40 UTSW 11 119,153,943 (GRCm39) missense probably benign 0.00
R3421:Ccdc40 UTSW 11 119,125,605 (GRCm39) missense probably benign 0.02
R3746:Ccdc40 UTSW 11 119,155,252 (GRCm39) missense probably benign 0.26
R3749:Ccdc40 UTSW 11 119,155,252 (GRCm39) missense probably benign 0.26
R3871:Ccdc40 UTSW 11 119,155,107 (GRCm39) missense probably damaging 1.00
R4508:Ccdc40 UTSW 11 119,133,335 (GRCm39) missense probably damaging 0.98
R4613:Ccdc40 UTSW 11 119,122,358 (GRCm39) missense probably benign 0.09
R4663:Ccdc40 UTSW 11 119,122,332 (GRCm39) missense probably benign 0.01
R4787:Ccdc40 UTSW 11 119,144,447 (GRCm39) missense possibly damaging 0.74
R4867:Ccdc40 UTSW 11 119,122,614 (GRCm39) missense probably benign
R5237:Ccdc40 UTSW 11 119,150,802 (GRCm39) missense probably benign 0.00
R5661:Ccdc40 UTSW 11 119,128,753 (GRCm39) missense probably benign 0.13
R5678:Ccdc40 UTSW 11 119,122,398 (GRCm39) missense possibly damaging 0.61
R5805:Ccdc40 UTSW 11 119,136,906 (GRCm39) critical splice donor site probably null
R5830:Ccdc40 UTSW 11 119,133,572 (GRCm39) missense probably benign 0.00
R5895:Ccdc40 UTSW 11 119,144,229 (GRCm39) missense probably damaging 1.00
R5932:Ccdc40 UTSW 11 119,141,838 (GRCm39) missense probably damaging 0.98
R6034:Ccdc40 UTSW 11 119,133,898 (GRCm39) missense possibly damaging 0.70
R6034:Ccdc40 UTSW 11 119,133,898 (GRCm39) missense possibly damaging 0.70
R6109:Ccdc40 UTSW 11 119,122,804 (GRCm39) missense probably benign
R6166:Ccdc40 UTSW 11 119,122,827 (GRCm39) missense probably benign
R6336:Ccdc40 UTSW 11 119,122,819 (GRCm39) missense possibly damaging 0.82
R6569:Ccdc40 UTSW 11 119,133,560 (GRCm39) missense probably damaging 1.00
R6884:Ccdc40 UTSW 11 119,133,565 (GRCm39) missense possibly damaging 0.82
R7022:Ccdc40 UTSW 11 119,122,612 (GRCm39) missense possibly damaging 0.82
R7212:Ccdc40 UTSW 11 119,155,270 (GRCm39) missense probably damaging 0.99
R7472:Ccdc40 UTSW 11 119,153,974 (GRCm39) missense probably benign 0.30
R7522:Ccdc40 UTSW 11 119,123,047 (GRCm39) missense possibly damaging 0.73
R7888:Ccdc40 UTSW 11 119,119,967 (GRCm39) missense unknown
R8041:Ccdc40 UTSW 11 119,122,507 (GRCm39) missense possibly damaging 0.53
R8117:Ccdc40 UTSW 11 119,144,211 (GRCm39) missense probably benign 0.00
R8162:Ccdc40 UTSW 11 119,150,870 (GRCm39) critical splice donor site probably null
R8514:Ccdc40 UTSW 11 119,121,459 (GRCm39) missense unknown
R8725:Ccdc40 UTSW 11 119,155,323 (GRCm39) missense probably benign
R8727:Ccdc40 UTSW 11 119,155,323 (GRCm39) missense probably benign
R8799:Ccdc40 UTSW 11 119,155,292 (GRCm39) missense probably benign 0.00
R8877:Ccdc40 UTSW 11 119,153,992 (GRCm39) missense probably damaging 1.00
R9304:Ccdc40 UTSW 11 119,122,597 (GRCm39) missense probably benign 0.06
S24628:Ccdc40 UTSW 11 119,122,944 (GRCm39) missense possibly damaging 0.92
Z1176:Ccdc40 UTSW 11 119,142,834 (GRCm39) missense probably damaging 1.00
Z1177:Ccdc40 UTSW 11 119,145,224 (GRCm39) missense probably benign 0.16
Z1177:Ccdc40 UTSW 11 119,128,933 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAAGTGACGTGGATGCTGGAG -3'
(R):5'- GCCCAGCCAATAACAGGTCGAG -3'

Sequencing Primer
(F):5'- AAGTTCCTAAGCAGCTCCCT -3'
(R):5'- TCGAGATCAGAACGCTGTGC -3'
Posted On 2014-04-13