Incidental Mutation 'R1531:Apob'
ID 166234
Institutional Source Beutler Lab
Gene Symbol Apob
Ensembl Gene ENSMUSG00000020609
Gene Name apolipoprotein B
Synonyms apob-100, apob-48
MMRRC Submission 039570-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.859) question?
Stock # R1531 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 8027648-8066835 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 8047880 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 953 (I953T)
Ref Sequence ENSEMBL: ENSMUSP00000036044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000037520
AA Change: I940T

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: I940T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 33 585 6.03e-94 SMART
DUF1943 619 932 7.88e-97 SMART
Pfam:DUF1081 945 1059 9.4e-32 PFAM
low complexity region 1100 1109 N/A INTRINSIC
Blast:LPD_N 1249 1311 9e-22 BLAST
low complexity region 1632 1644 N/A INTRINSIC
internal_repeat_1 1882 2038 6.61e-9 PROSPERO
SCOP:d1gw5a_ 2105 2577 9e-5 SMART
internal_repeat_1 2973 3150 6.61e-9 PROSPERO
low complexity region 3561 3580 N/A INTRINSIC
low complexity region 3928 3936 N/A INTRINSIC
Pfam:ApoB100_C 4401 4456 5.6e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000037811
AA Change: I953T

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: I953T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 46 598 6.03e-94 SMART
DUF1943 632 945 7.88e-97 SMART
Pfam:DUF1081 960 1070 6.3e-39 PFAM
low complexity region 1113 1122 N/A INTRINSIC
Blast:LPD_N 1282 1344 1e-21 BLAST
low complexity region 1665 1677 N/A INTRINSIC
internal_repeat_1 1915 2071 6.6e-9 PROSPERO
SCOP:d1gw5a_ 2138 2610 9e-5 SMART
internal_repeat_1 3006 3183 6.6e-9 PROSPERO
low complexity region 3594 3613 N/A INTRINSIC
low complexity region 3961 3969 N/A INTRINSIC
Pfam:ApoB100_C 4434 4490 1.6e-32 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T A 13: 59,648,448 (GRCm39) probably null Het
Aldh3b2 T G 19: 4,027,543 (GRCm39) F28C probably damaging Het
Apaf1 T C 10: 90,890,383 (GRCm39) N540S probably damaging Het
Arhgef1 A G 7: 24,624,423 (GRCm39) T816A probably damaging Het
Arid4a T A 12: 71,122,779 (GRCm39) F1053L probably benign Het
Atxn1l A C 8: 110,458,691 (GRCm39) F524V probably damaging Het
Cad T A 5: 31,233,563 (GRCm39) M1874K probably benign Het
Ccdc40 G A 11: 119,154,015 (GRCm39) V1096I probably benign Het
Ccdc93 A G 1: 121,408,551 (GRCm39) D358G probably benign Het
Cd96 T C 16: 45,938,169 (GRCm39) T99A probably benign Het
Cdc42ep3 A T 17: 79,642,473 (GRCm39) M149K probably benign Het
Cgas A G 9: 78,349,763 (GRCm39) Y200H probably damaging Het
Cog4 A G 8: 111,606,353 (GRCm39) E613G probably benign Het
Crebbp A T 16: 3,902,381 (GRCm39) I2286N probably benign Het
Csf1 T C 3: 107,655,654 (GRCm39) E459G possibly damaging Het
Csrp2 A T 10: 110,771,066 (GRCm39) Y57F probably benign Het
Ctdspl C T 9: 118,869,650 (GRCm39) P244L probably damaging Het
Cyp2c29 A G 19: 39,313,412 (GRCm39) R303G probably damaging Het
Cyp4a10 C A 4: 115,375,632 (GRCm39) Y38* probably null Het
Dmgdh T A 13: 93,880,919 (GRCm39) I783N probably damaging Het
Efcc1 G A 6: 87,708,148 (GRCm39) E92K probably benign Het
Eif2ak4 T A 2: 118,273,691 (GRCm39) L872H probably damaging Het
Elp2 T A 18: 24,764,461 (GRCm39) S603T probably benign Het
Eml2 T A 7: 18,930,179 (GRCm39) L300H probably damaging Het
Esp3 A G 17: 40,946,827 (GRCm39) K50R possibly damaging Het
Esrp1 A G 4: 11,379,375 (GRCm39) F136L probably damaging Het
Exoc1 T A 5: 76,707,011 (GRCm39) D497E probably damaging Het
Fat3 A G 9: 15,908,761 (GRCm39) S2414P probably damaging Het
Foxj3 C T 4: 119,477,398 (GRCm39) P369S unknown Het
Gkn2 G T 6: 87,352,921 (GRCm39) probably null Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,649,766 (GRCm39) noncoding transcript Het
Gm21905 A T 5: 68,103,724 (GRCm39) probably benign Het
Grhl1 T A 12: 24,632,962 (GRCm39) probably null Het
Grk6 A G 13: 55,599,967 (GRCm39) Y221C probably damaging Het
Hcrtr1 T A 4: 130,024,720 (GRCm39) K389* probably null Het
Hk1 G A 10: 62,120,563 (GRCm39) R545C probably damaging Het
Hsp90b1 A T 10: 86,532,659 (GRCm39) I339N probably benign Het
Ikzf3 T C 11: 98,381,272 (GRCm39) R103G probably damaging Het
Itgad A C 7: 127,777,542 (GRCm39) I141L probably benign Het
Jmjd6 T A 11: 116,733,266 (GRCm39) Y137F probably benign Het
Kcna1 A G 6: 126,619,030 (GRCm39) V430A probably benign Het
Kel A G 6: 41,665,560 (GRCm39) V520A probably damaging Het
Klhl41 G A 2: 69,501,084 (GRCm39) V182I probably benign Het
Ldhb C A 6: 142,447,121 (GRCm39) M64I probably benign Het
Lrrc23 A G 6: 124,753,077 (GRCm39) S190P possibly damaging Het
Mboat2 T C 12: 25,009,029 (GRCm39) V445A probably benign Het
Mlycd G A 8: 120,128,258 (GRCm39) W188* probably null Het
Mpp3 C T 11: 101,899,475 (GRCm39) E349K probably benign Het
Mtres1 A G 10: 43,401,316 (GRCm39) V211A probably benign Het
Myh4 A G 11: 67,141,366 (GRCm39) M780V probably benign Het
Myh6 G A 14: 55,193,963 (GRCm39) R809C probably damaging Het
Mylip G A 13: 45,560,046 (GRCm39) V161M possibly damaging Het
Nrp1 G A 8: 129,152,450 (GRCm39) V220I probably null Het
Nup210 A T 6: 91,011,823 (GRCm39) N455K probably benign Het
Or14j10 A T 17: 37,935,243 (GRCm39) Y94* probably null Het
Or51f1d C A 7: 102,700,795 (GRCm39) Q97K probably benign Het
Pbld2 G T 10: 62,889,732 (GRCm39) probably null Het
Pclo C G 5: 14,571,917 (GRCm39) P434R probably damaging Het
Pdlim3 A G 8: 46,349,800 (GRCm39) K37E probably damaging Het
Prkdc T A 16: 15,589,970 (GRCm39) I2611N probably benign Het
Prr12 T C 7: 44,677,954 (GRCm39) D2019G unknown Het
Rab27a A G 9: 73,002,685 (GRCm39) T205A probably benign Het
Rcan3 A G 4: 135,152,595 (GRCm39) L42P probably damaging Het
Rchy1 T C 5: 92,103,474 (GRCm39) probably null Het
Sema6a T C 18: 47,382,066 (GRCm39) H827R probably damaging Het
Sertad4 A G 1: 192,533,258 (GRCm39) probably null Het
Smarcd1 T A 15: 99,605,264 (GRCm39) C282S probably damaging Het
Speg A G 1: 75,377,866 (GRCm39) T769A possibly damaging Het
Syne1 T A 10: 5,297,875 (GRCm39) K1141* probably null Het
Synpo2 T C 3: 122,911,315 (GRCm39) E110G probably benign Het
Tg T A 15: 66,722,351 (GRCm39) D333E probably benign Het
Tmem132c A G 5: 127,436,955 (GRCm39) Y148C probably damaging Het
Tmem215 T A 4: 40,473,965 (GRCm39) V14E probably damaging Het
Tmem229b A G 12: 79,011,685 (GRCm39) L82P probably damaging Het
Togaram1 A G 12: 65,013,039 (GRCm39) T97A probably benign Het
Trappc9 G A 15: 72,565,397 (GRCm39) R965* probably null Het
Trio T C 15: 27,833,071 (GRCm39) I104V probably benign Het
Trp73 A G 4: 154,148,352 (GRCm39) F354S probably benign Het
Ttyh2 T C 11: 114,577,278 (GRCm39) L63P probably damaging Het
Ulk4 G C 9: 120,873,841 (GRCm39) P1197A probably damaging Het
Vmn1r176 T C 7: 23,534,536 (GRCm39) M206V possibly damaging Het
Vps8 T A 16: 21,285,226 (GRCm39) Y402* probably null Het
Zbtb41 A G 1: 139,350,931 (GRCm39) I15V probably benign Het
Zc3hav1 T C 6: 38,284,170 (GRCm39) I982V possibly damaging Het
Zmynd19 T A 2: 24,848,123 (GRCm39) N106K probably benign Het
Other mutations in Apob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Apob APN 12 8,043,065 (GRCm39) splice site probably benign
IGL00421:Apob APN 12 8,060,197 (GRCm39) missense probably damaging 0.99
IGL00658:Apob APN 12 8,059,471 (GRCm39) missense probably benign 0.08
IGL00768:Apob APN 12 8,052,107 (GRCm39) missense probably damaging 1.00
IGL00833:Apob APN 12 8,060,101 (GRCm39) missense probably benign 0.14
IGL00926:Apob APN 12 8,065,421 (GRCm39) missense probably benign 0.01
IGL01065:Apob APN 12 8,053,299 (GRCm39) missense probably damaging 0.99
IGL01313:Apob APN 12 8,050,898 (GRCm39) missense probably damaging 1.00
IGL01419:Apob APN 12 8,052,251 (GRCm39) missense probably damaging 0.99
IGL01461:Apob APN 12 8,051,884 (GRCm39) missense probably benign 0.13
IGL02002:Apob APN 12 8,044,822 (GRCm39) missense probably benign 0.03
IGL02031:Apob APN 12 8,065,222 (GRCm39) missense probably benign
IGL02102:Apob APN 12 8,039,407 (GRCm39) missense possibly damaging 0.94
IGL02115:Apob APN 12 8,042,923 (GRCm39) missense probably benign 0.06
IGL02513:Apob APN 12 8,042,979 (GRCm39) missense probably benign 0.01
IGL02967:Apob APN 12 8,065,366 (GRCm39) nonsense probably null
IGL03005:Apob APN 12 8,043,059 (GRCm39) splice site probably benign
IGL03011:Apob APN 12 8,047,883 (GRCm39) missense probably damaging 1.00
IGL03116:Apob APN 12 8,066,350 (GRCm39) missense probably damaging 0.98
IGL03215:Apob APN 12 8,063,818 (GRCm39) missense possibly damaging 0.92
IGL03227:Apob APN 12 8,066,089 (GRCm39) missense probably benign 0.04
Aesthete UTSW 12 8,060,080 (GRCm39) nonsense probably null
Essence UTSW 12 8,057,769 (GRCm39) nonsense probably null
Ethos UTSW 12 8,040,394 (GRCm39) missense probably null 1.00
IGL02835:Apob UTSW 12 8,065,097 (GRCm39) missense possibly damaging 0.86
IGL02837:Apob UTSW 12 8,055,102 (GRCm39) missense probably damaging 1.00
R0071:Apob UTSW 12 8,052,111 (GRCm39) missense probably damaging 0.98
R0071:Apob UTSW 12 8,052,111 (GRCm39) missense probably damaging 0.98
R0116:Apob UTSW 12 8,039,113 (GRCm39) unclassified probably benign
R0180:Apob UTSW 12 8,058,285 (GRCm39) nonsense probably null
R0288:Apob UTSW 12 8,040,779 (GRCm39) nonsense probably null
R0295:Apob UTSW 12 8,052,181 (GRCm39) nonsense probably null
R0305:Apob UTSW 12 8,062,210 (GRCm39) missense probably damaging 1.00
R0312:Apob UTSW 12 8,059,034 (GRCm39) missense probably benign
R0324:Apob UTSW 12 8,060,521 (GRCm39) missense probably benign 0.41
R0326:Apob UTSW 12 8,040,307 (GRCm39) missense probably damaging 1.00
R0363:Apob UTSW 12 8,060,136 (GRCm39) missense probably damaging 1.00
R0390:Apob UTSW 12 8,038,678 (GRCm39) missense probably damaging 0.99
R0462:Apob UTSW 12 8,050,896 (GRCm39) missense probably damaging 1.00
R0471:Apob UTSW 12 8,040,406 (GRCm39) missense probably damaging 1.00
R0532:Apob UTSW 12 8,066,188 (GRCm39) missense possibly damaging 0.48
R0548:Apob UTSW 12 8,056,282 (GRCm39) missense probably damaging 1.00
R0560:Apob UTSW 12 8,055,101 (GRCm39) missense probably damaging 1.00
R0595:Apob UTSW 12 8,058,369 (GRCm39) missense probably benign 0.01
R0600:Apob UTSW 12 8,056,440 (GRCm39) missense probably damaging 1.00
R0626:Apob UTSW 12 8,066,193 (GRCm39) missense probably benign 0.45
R0685:Apob UTSW 12 8,060,742 (GRCm39) missense probably benign
R0765:Apob UTSW 12 8,066,518 (GRCm39) missense probably benign
R0790:Apob UTSW 12 8,060,245 (GRCm39) missense probably damaging 1.00
R0918:Apob UTSW 12 8,033,941 (GRCm39) missense probably benign 0.10
R0962:Apob UTSW 12 8,039,191 (GRCm39) missense probably damaging 0.98
R1055:Apob UTSW 12 8,044,963 (GRCm39) missense probably damaging 1.00
R1077:Apob UTSW 12 8,056,017 (GRCm39) missense probably benign
R1143:Apob UTSW 12 8,062,354 (GRCm39) missense probably benign 0.26
R1163:Apob UTSW 12 8,061,654 (GRCm39) missense probably damaging 1.00
R1266:Apob UTSW 12 8,056,093 (GRCm39) missense probably benign 0.37
R1434:Apob UTSW 12 8,059,715 (GRCm39) missense probably damaging 1.00
R1442:Apob UTSW 12 8,036,165 (GRCm39) missense probably benign 0.31
R1445:Apob UTSW 12 8,066,084 (GRCm39) missense possibly damaging 0.48
R1459:Apob UTSW 12 8,061,937 (GRCm39) missense possibly damaging 0.92
R1459:Apob UTSW 12 8,056,047 (GRCm39) missense probably benign
R1465:Apob UTSW 12 8,061,421 (GRCm39) missense possibly damaging 0.91
R1465:Apob UTSW 12 8,061,421 (GRCm39) missense possibly damaging 0.91
R1508:Apob UTSW 12 8,061,481 (GRCm39) missense possibly damaging 0.92
R1518:Apob UTSW 12 8,039,207 (GRCm39) missense probably benign 0.01
R1547:Apob UTSW 12 8,053,368 (GRCm39) missense probably benign 0.08
R1574:Apob UTSW 12 8,040,839 (GRCm39) missense possibly damaging 0.51
R1574:Apob UTSW 12 8,040,839 (GRCm39) missense possibly damaging 0.51
R1682:Apob UTSW 12 8,062,365 (GRCm39) missense probably benign 0.00
R1709:Apob UTSW 12 8,059,306 (GRCm39) missense probably damaging 0.98
R1718:Apob UTSW 12 8,066,087 (GRCm39) missense probably benign 0.02
R1752:Apob UTSW 12 8,038,766 (GRCm39) missense probably benign 0.01
R1781:Apob UTSW 12 8,059,603 (GRCm39) missense possibly damaging 0.96
R1818:Apob UTSW 12 8,063,064 (GRCm39) missense possibly damaging 0.93
R1818:Apob UTSW 12 8,056,834 (GRCm39) missense probably damaging 0.98
R1842:Apob UTSW 12 8,061,559 (GRCm39) missense probably damaging 1.00
R1843:Apob UTSW 12 8,057,602 (GRCm39) missense possibly damaging 0.65
R1853:Apob UTSW 12 8,060,928 (GRCm39) nonsense probably null
R1990:Apob UTSW 12 8,051,039 (GRCm39) missense probably damaging 1.00
R2016:Apob UTSW 12 8,057,751 (GRCm39) missense possibly damaging 0.48
R2017:Apob UTSW 12 8,057,751 (GRCm39) missense possibly damaging 0.48
R2023:Apob UTSW 12 8,061,090 (GRCm39) missense probably benign 0.01
R2037:Apob UTSW 12 8,057,488 (GRCm39) missense probably benign 0.37
R2054:Apob UTSW 12 8,063,134 (GRCm39) missense probably damaging 1.00
R2057:Apob UTSW 12 8,052,164 (GRCm39) nonsense probably null
R2085:Apob UTSW 12 8,062,240 (GRCm39) missense probably damaging 1.00
R2159:Apob UTSW 12 8,060,081 (GRCm39) missense probably benign 0.12
R2209:Apob UTSW 12 8,057,752 (GRCm39) missense probably benign 0.28
R2249:Apob UTSW 12 8,057,499 (GRCm39) missense probably damaging 1.00
R2254:Apob UTSW 12 8,061,256 (GRCm39) missense possibly damaging 0.92
R2265:Apob UTSW 12 8,065,475 (GRCm39) missense possibly damaging 0.74
R2266:Apob UTSW 12 8,065,475 (GRCm39) missense possibly damaging 0.74
R2267:Apob UTSW 12 8,065,475 (GRCm39) missense possibly damaging 0.74
R2268:Apob UTSW 12 8,065,475 (GRCm39) missense possibly damaging 0.74
R2296:Apob UTSW 12 8,044,879 (GRCm39) missense probably damaging 0.97
R2897:Apob UTSW 12 8,060,356 (GRCm39) missense probably damaging 1.00
R3431:Apob UTSW 12 8,060,778 (GRCm39) missense probably damaging 1.00
R3723:Apob UTSW 12 8,061,763 (GRCm39) missense possibly damaging 0.46
R3723:Apob UTSW 12 8,056,327 (GRCm39) missense probably damaging 1.00
R3899:Apob UTSW 12 8,065,849 (GRCm39) missense possibly damaging 0.87
R4020:Apob UTSW 12 8,044,914 (GRCm39) nonsense probably null
R4050:Apob UTSW 12 8,065,390 (GRCm39) missense probably benign 0.02
R4351:Apob UTSW 12 8,043,054 (GRCm39) missense probably benign 0.03
R4365:Apob UTSW 12 8,066,083 (GRCm39) missense possibly damaging 0.95
R4366:Apob UTSW 12 8,066,083 (GRCm39) missense possibly damaging 0.95
R4456:Apob UTSW 12 8,065,445 (GRCm39) missense probably damaging 1.00
R4458:Apob UTSW 12 8,065,445 (GRCm39) missense probably damaging 1.00
R4600:Apob UTSW 12 8,058,568 (GRCm39) missense probably damaging 1.00
R4611:Apob UTSW 12 8,061,331 (GRCm39) missense probably damaging 1.00
R4646:Apob UTSW 12 8,062,759 (GRCm39) missense probably benign 0.21
R4678:Apob UTSW 12 8,045,585 (GRCm39) missense probably damaging 1.00
R4685:Apob UTSW 12 8,056,456 (GRCm39) missense probably benign 0.00
R4707:Apob UTSW 12 8,056,205 (GRCm39) missense probably damaging 0.96
R4726:Apob UTSW 12 8,040,267 (GRCm39) missense probably damaging 0.98
R4792:Apob UTSW 12 8,058,051 (GRCm39) missense probably benign 0.26
R4822:Apob UTSW 12 8,065,741 (GRCm39) missense probably benign 0.04
R4834:Apob UTSW 12 8,064,101 (GRCm39) missense possibly damaging 0.49
R4835:Apob UTSW 12 8,065,391 (GRCm39) missense possibly damaging 0.56
R4887:Apob UTSW 12 8,063,099 (GRCm39) missense probably damaging 1.00
R4910:Apob UTSW 12 8,057,848 (GRCm39) missense probably damaging 1.00
R5072:Apob UTSW 12 8,058,714 (GRCm39) missense probably benign 0.00
R5073:Apob UTSW 12 8,055,219 (GRCm39) critical splice donor site probably null
R5074:Apob UTSW 12 8,055,219 (GRCm39) critical splice donor site probably null
R5101:Apob UTSW 12 8,061,934 (GRCm39) missense probably benign 0.09
R5123:Apob UTSW 12 8,057,630 (GRCm39) splice site probably null
R5133:Apob UTSW 12 8,058,898 (GRCm39) missense probably damaging 0.99
R5135:Apob UTSW 12 8,060,086 (GRCm39) missense probably damaging 1.00
R5137:Apob UTSW 12 8,061,384 (GRCm39) missense possibly damaging 0.63
R5160:Apob UTSW 12 8,062,126 (GRCm39) missense possibly damaging 0.90
R5173:Apob UTSW 12 8,058,238 (GRCm39) missense probably benign 0.00
R5202:Apob UTSW 12 8,063,737 (GRCm39) missense probably damaging 0.98
R5229:Apob UTSW 12 8,027,806 (GRCm39) missense probably benign
R5292:Apob UTSW 12 8,055,912 (GRCm39) missense probably benign 0.01
R5378:Apob UTSW 12 8,061,865 (GRCm39) missense probably damaging 0.99
R5494:Apob UTSW 12 8,061,762 (GRCm39) missense probably damaging 0.99
R5517:Apob UTSW 12 8,040,906 (GRCm39) missense probably damaging 1.00
R5576:Apob UTSW 12 8,048,662 (GRCm39) missense probably damaging 1.00
R5582:Apob UTSW 12 8,060,788 (GRCm39) missense probably damaging 1.00
R5629:Apob UTSW 12 8,057,847 (GRCm39) missense probably damaging 1.00
R5678:Apob UTSW 12 8,041,494 (GRCm39) missense possibly damaging 0.92
R5732:Apob UTSW 12 8,060,353 (GRCm39) missense probably benign 0.15
R5734:Apob UTSW 12 8,038,781 (GRCm39) missense probably damaging 1.00
R5742:Apob UTSW 12 8,057,191 (GRCm39) missense probably damaging 1.00
R5751:Apob UTSW 12 8,062,619 (GRCm39) nonsense probably null
R5776:Apob UTSW 12 8,056,149 (GRCm39) missense possibly damaging 0.57
R5778:Apob UTSW 12 8,065,074 (GRCm39) missense probably benign 0.45
R5783:Apob UTSW 12 8,051,022 (GRCm39) missense probably damaging 1.00
R5786:Apob UTSW 12 8,065,304 (GRCm39) missense possibly damaging 0.48
R5837:Apob UTSW 12 8,053,277 (GRCm39) missense probably benign 0.04
R5857:Apob UTSW 12 8,065,397 (GRCm39) missense probably benign 0.00
R6029:Apob UTSW 12 8,066,243 (GRCm39) missense probably damaging 0.99
R6032:Apob UTSW 12 8,045,513 (GRCm39) missense probably benign 0.02
R6032:Apob UTSW 12 8,045,513 (GRCm39) missense probably benign 0.02
R6086:Apob UTSW 12 8,065,164 (GRCm39) missense probably benign
R6110:Apob UTSW 12 8,061,883 (GRCm39) missense probably damaging 1.00
R6131:Apob UTSW 12 8,065,874 (GRCm39) missense probably benign 0.17
R6157:Apob UTSW 12 8,056,077 (GRCm39) missense probably benign
R6179:Apob UTSW 12 8,055,060 (GRCm39) nonsense probably null
R6247:Apob UTSW 12 8,051,801 (GRCm39) missense probably damaging 1.00
R6279:Apob UTSW 12 8,057,769 (GRCm39) nonsense probably null
R6300:Apob UTSW 12 8,057,769 (GRCm39) nonsense probably null
R6320:Apob UTSW 12 8,039,194 (GRCm39) missense probably benign 0.27
R6339:Apob UTSW 12 8,066,188 (GRCm39) missense probably damaging 0.99
R6353:Apob UTSW 12 8,059,421 (GRCm39) missense probably damaging 1.00
R6395:Apob UTSW 12 8,058,507 (GRCm39) missense probably benign 0.45
R6441:Apob UTSW 12 8,037,796 (GRCm39) missense probably damaging 1.00
R6492:Apob UTSW 12 8,058,261 (GRCm39) missense probably damaging 0.99
R6495:Apob UTSW 12 8,040,394 (GRCm39) missense probably null 1.00
R6502:Apob UTSW 12 8,051,814 (GRCm39) missense probably damaging 0.99
R6520:Apob UTSW 12 8,033,124 (GRCm39) missense probably damaging 1.00
R6644:Apob UTSW 12 8,059,077 (GRCm39) missense probably damaging 0.97
R6704:Apob UTSW 12 8,060,379 (GRCm39) missense probably damaging 0.98
R6750:Apob UTSW 12 8,047,853 (GRCm39) missense probably damaging 1.00
R6759:Apob UTSW 12 8,061,049 (GRCm39) missense probably benign 0.06
R6812:Apob UTSW 12 8,033,062 (GRCm39) missense probably damaging 0.98
R6865:Apob UTSW 12 8,058,847 (GRCm39) missense probably benign 0.05
R6873:Apob UTSW 12 8,065,995 (GRCm39) missense probably benign 0.00
R7013:Apob UTSW 12 8,060,080 (GRCm39) nonsense probably null
R7067:Apob UTSW 12 8,059,423 (GRCm39) missense probably damaging 1.00
R7084:Apob UTSW 12 8,059,591 (GRCm39) missense probably benign
R7113:Apob UTSW 12 8,045,539 (GRCm39) missense probably damaging 1.00
R7175:Apob UTSW 12 8,057,034 (GRCm39) missense probably benign 0.33
R7196:Apob UTSW 12 8,033,893 (GRCm39) missense possibly damaging 0.90
R7199:Apob UTSW 12 8,055,072 (GRCm39) missense probably damaging 1.00
R7205:Apob UTSW 12 8,055,087 (GRCm39) missense probably damaging 0.98
R7251:Apob UTSW 12 8,057,037 (GRCm39) missense probably damaging 0.98
R7474:Apob UTSW 12 8,059,185 (GRCm39) missense probably benign 0.29
R7484:Apob UTSW 12 8,056,884 (GRCm39) nonsense probably null
R7538:Apob UTSW 12 8,052,219 (GRCm39) missense probably damaging 0.98
R7636:Apob UTSW 12 8,059,516 (GRCm39) missense possibly damaging 0.86
R7646:Apob UTSW 12 8,059,189 (GRCm39) missense probably damaging 0.99
R7787:Apob UTSW 12 8,040,780 (GRCm39) missense probably damaging 0.97
R7793:Apob UTSW 12 8,058,124 (GRCm39) missense probably damaging 0.99
R7836:Apob UTSW 12 8,051,885 (GRCm39) missense possibly damaging 0.72
R7895:Apob UTSW 12 8,061,933 (GRCm39) missense probably benign 0.00
R8005:Apob UTSW 12 8,059,744 (GRCm39) missense probably benign 0.01
R8013:Apob UTSW 12 8,060,798 (GRCm39) missense possibly damaging 0.94
R8014:Apob UTSW 12 8,060,798 (GRCm39) missense possibly damaging 0.94
R8111:Apob UTSW 12 8,058,801 (GRCm39) missense probably benign 0.16
R8117:Apob UTSW 12 8,056,435 (GRCm39) missense probably damaging 0.99
R8226:Apob UTSW 12 8,059,056 (GRCm39) missense probably benign 0.00
R8244:Apob UTSW 12 8,060,548 (GRCm39) missense probably damaging 0.96
R8280:Apob UTSW 12 8,060,851 (GRCm39) missense possibly damaging 0.46
R8310:Apob UTSW 12 8,059,033 (GRCm39) missense probably benign 0.00
R8327:Apob UTSW 12 8,051,015 (GRCm39) missense possibly damaging 0.72
R8329:Apob UTSW 12 8,061,135 (GRCm39) missense probably damaging 0.98
R8331:Apob UTSW 12 8,051,882 (GRCm39) missense probably benign 0.28
R8351:Apob UTSW 12 8,056,356 (GRCm39) missense probably benign 0.29
R8412:Apob UTSW 12 8,058,069 (GRCm39) missense probably benign 0.33
R8425:Apob UTSW 12 8,038,842 (GRCm39) missense possibly damaging 0.70
R8481:Apob UTSW 12 8,044,807 (GRCm39) splice site probably null
R8493:Apob UTSW 12 8,059,009 (GRCm39) missense possibly damaging 0.87
R8529:Apob UTSW 12 8,057,353 (GRCm39) missense probably damaging 1.00
R8554:Apob UTSW 12 8,037,830 (GRCm39) missense probably damaging 0.98
R8692:Apob UTSW 12 8,058,270 (GRCm39) missense probably damaging 0.98
R8695:Apob UTSW 12 8,057,830 (GRCm39) missense probably damaging 1.00
R8977:Apob UTSW 12 8,065,990 (GRCm39) missense probably damaging 0.99
R9016:Apob UTSW 12 8,035,408 (GRCm39) splice site silent
R9020:Apob UTSW 12 8,063,999 (GRCm39) missense probably damaging 1.00
R9037:Apob UTSW 12 8,066,501 (GRCm39) missense probably benign 0.15
R9053:Apob UTSW 12 8,058,954 (GRCm39) missense possibly damaging 0.72
R9062:Apob UTSW 12 8,058,046 (GRCm39) missense possibly damaging 0.91
R9142:Apob UTSW 12 8,062,705 (GRCm39) missense possibly damaging 0.95
R9180:Apob UTSW 12 8,047,925 (GRCm39) missense probably damaging 1.00
R9205:Apob UTSW 12 8,030,635 (GRCm39) missense probably damaging 0.99
R9248:Apob UTSW 12 8,065,231 (GRCm39) nonsense probably null
R9277:Apob UTSW 12 8,061,183 (GRCm39) missense probably benign 0.01
R9305:Apob UTSW 12 8,058,053 (GRCm39) missense probably benign 0.04
R9358:Apob UTSW 12 8,060,833 (GRCm39) missense probably benign 0.14
R9375:Apob UTSW 12 8,029,261 (GRCm39) missense possibly damaging 0.91
R9385:Apob UTSW 12 8,056,399 (GRCm39) missense possibly damaging 0.91
R9386:Apob UTSW 12 8,056,629 (GRCm39) missense probably damaging 0.99
R9392:Apob UTSW 12 8,057,098 (GRCm39) missense probably benign 0.45
R9470:Apob UTSW 12 8,039,219 (GRCm39) missense possibly damaging 0.94
R9523:Apob UTSW 12 8,052,069 (GRCm39) missense probably damaging 1.00
R9545:Apob UTSW 12 8,033,890 (GRCm39) missense possibly damaging 0.81
R9629:Apob UTSW 12 8,059,054 (GRCm39) missense probably damaging 1.00
R9702:Apob UTSW 12 8,057,559 (GRCm39) missense probably damaging 0.96
R9703:Apob UTSW 12 8,030,507 (GRCm39) missense probably damaging 0.99
R9719:Apob UTSW 12 8,065,464 (GRCm39) missense probably benign 0.15
R9726:Apob UTSW 12 8,056,926 (GRCm39) missense probably damaging 0.99
R9729:Apob UTSW 12 8,066,125 (GRCm39) missense probably damaging 0.99
X0027:Apob UTSW 12 8,057,975 (GRCm39) missense probably benign
Z1088:Apob UTSW 12 8,062,936 (GRCm39) missense possibly damaging 0.95
Z1088:Apob UTSW 12 8,055,945 (GRCm39) nonsense probably null
Z1088:Apob UTSW 12 8,055,074 (GRCm39) missense possibly damaging 0.91
Z1176:Apob UTSW 12 8,054,978 (GRCm39) missense probably benign 0.00
Z1176:Apob UTSW 12 8,048,011 (GRCm39) missense probably damaging 1.00
Z1177:Apob UTSW 12 8,065,249 (GRCm39) frame shift probably null
Z1177:Apob UTSW 12 8,038,765 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TGATGCTCTTTGGACTCATAGCTGC -3'
(R):5'- TGGACAGACTAGACCCTACTGCAAC -3'

Sequencing Primer
(F):5'- GACTCATAGCTGCTTCTCAGTAAAC -3'
(R):5'- AGGACCACTGTTTGAAGCTC -3'
Posted On 2014-04-13