Mutagenetix > Incidental Mutation

Incidental Mutation 'R1527:Mga'

166268

Institutional Source

Beutler Lab

Gene Symbol

Mga

Ensembl Gene

ENSMUSG00000033943

Gene Name

MAX gene associated

Synonyms

D030062C11Rik, Mga, Mad5, C130042M01Rik

MMRRC Submission

039567-MU

Accession Numbers

Ncbi RefSeq: NM_013720.2, NM_001164274.1; MGI: 1352483

Essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R1527 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119897228-119969581 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119916597 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 410 (T410A)

Ref Sequence

ENSEMBL: ENSMUSP00000106401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000046717
AA Change: T410A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: T410A

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	6e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1301	1315	N/A	INTRINSIC
low complexity region	1564	1581	N/A	INTRINSIC
low complexity region	1634	1649	N/A	INTRINSIC
low complexity region	1681	1716	N/A	INTRINSIC
low complexity region	1796	1818	N/A	INTRINSIC
low complexity region	1833	1850	N/A	INTRINSIC
low complexity region	1977	1992	N/A	INTRINSIC
low complexity region	2183	2197	N/A	INTRINSIC
low complexity region	2241	2259	N/A	INTRINSIC
HLH	2368	2419	8.27e-7	SMART
low complexity region	2748	2769	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000079934
AA Change: T410A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: T410A

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	5e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1300	1314	N/A	INTRINSIC
low complexity region	1626	1648	N/A	INTRINSIC
low complexity region	1663	1680	N/A	INTRINSIC
low complexity region	1807	1822	N/A	INTRINSIC
low complexity region	2013	2027	N/A	INTRINSIC
low complexity region	2071	2089	N/A	INTRINSIC
HLH	2198	2249	8.27e-7	SMART
low complexity region	2578	2599	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110773
AA Change: T410A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: T410A

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	5e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	890	899	N/A	INTRINSIC
low complexity region	938	952	N/A	INTRINSIC
low complexity region	1033	1059	N/A	INTRINSIC
low complexity region	1169	1190	N/A	INTRINSIC
low complexity region	1222	1236	N/A	INTRINSIC
low complexity region	1485	1502	N/A	INTRINSIC
low complexity region	1555	1570	N/A	INTRINSIC
low complexity region	1602	1637	N/A	INTRINSIC
low complexity region	1717	1739	N/A	INTRINSIC
low complexity region	1754	1771	N/A	INTRINSIC
low complexity region	1898	1913	N/A	INTRINSIC
low complexity region	2104	2118	N/A	INTRINSIC
low complexity region	2162	2180	N/A	INTRINSIC
HLH	2289	2340	8.27e-7	SMART
low complexity region	2669	2690	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110774
AA Change: T410A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: T410A

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	7e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
Pfam:DUF4801	1037	1085	1e-19	PFAM
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1301	1315	N/A	INTRINSIC
low complexity region	1564	1581	N/A	INTRINSIC
low complexity region	1634	1649	N/A	INTRINSIC
low complexity region	1681	1716	N/A	INTRINSIC
low complexity region	1835	1857	N/A	INTRINSIC
low complexity region	1872	1889	N/A	INTRINSIC
low complexity region	2016	2031	N/A	INTRINSIC
low complexity region	2222	2236	N/A	INTRINSIC
low complexity region	2280	2298	N/A	INTRINSIC
HLH	2407	2458	8.27e-7	SMART
low complexity region	2787	2808	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129405

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141776

Predicted Effect

probably damaging
Transcript: ENSMUST00000156510
AA Change: T410A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943
AA Change: T410A

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	4e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1300	1314	N/A	INTRINSIC
low complexity region	1626	1648	N/A	INTRINSIC
low complexity region	1663	1680	N/A	INTRINSIC
low complexity region	1807	1822	N/A	INTRINSIC
low complexity region	2013	2027	N/A	INTRINSIC
low complexity region	2071	2089	N/A	INTRINSIC
HLH	2198	2249	8.27e-7	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]

Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110059E24Rik	C	A	19: 21,598,269	C130F	probably damaging	Het
4933402N03Rik	T	C	7: 131,138,860	D209G	probably benign	Het
Adam7	A	G	14: 68,501,521	V744A	probably benign	Het
Atr	G	T	9: 95,870,043	R571I	possibly damaging	Het
C5ar1	A	G	7: 16,248,193	Y301H	probably damaging	Het
Cacna1d	A	G	14: 30,107,796	I954T	probably damaging	Het
Ccdc157	A	G	11: 4,151,795	F42S	probably damaging	Het
Chd2	A	T	7: 73,490,614	L622*	probably null	Het
Csmd3	T	C	15: 47,948,087	T1203A	probably benign	Het
Cxcl17	A	G	7: 25,402,211	V67A	possibly damaging	Het
Ddx4	T	C	13: 112,622,239	T263A	possibly damaging	Het
Eps8l1	A	G	7: 4,471,394	D288G	probably benign	Het
Fam208a	T	C	14: 27,480,093		probably null	Het
Fbxl4	A	G	4: 22,386,154	K254E	probably benign	Het
Glis1	T	C	4: 107,567,926	S245P	probably damaging	Het
Gm11111	T	C	5: 98,553,528		probably benign	Het
Haus3	A	T	5: 34,154,053	H544Q	probably benign	Het
Hmcn1	A	G	1: 150,773,803	V644A	probably benign	Het
Lmo7	T	C	14: 101,876,828	L2P	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Mical3	T	C	6: 121,024,779	D584G	probably damaging	Het
Miga1	A	T	3: 152,317,663	F250L	possibly damaging	Het
Mroh1	A	G	15: 76,452,263	D1553G	probably benign	Het
Myof	T	C	19: 37,924,619	Y1462C	probably damaging	Het
Notch4	T	C	17: 34,565,744	C144R	probably damaging	Het
Obox1	T	C	7: 15,555,325	V55A	probably damaging	Het
Olfr1241	C	T	2: 89,482,532	G201D	probably benign	Het
Olfr761	T	A	17: 37,952,829	H65L	possibly damaging	Het
Olfr822	T	A	10: 130,075,192	S261T	probably damaging	Het
Pclo	T	C	5: 14,679,648		probably benign	Het
Prr14l	C	T	5: 32,827,949	V1401I	possibly damaging	Het
Rad51ap1	T	C	6: 126,928,167		probably null	Het
Rev3l	T	A	10: 39,822,822	V1105D	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sgsm2	A	T	11: 74,853,848	C848*	probably null	Het
Slc39a10	A	T	1: 46,819,262	V625E	probably benign	Het
Spry4	C	T	18: 38,590,577	M44I	probably benign	Het
Stat5b	A	T	11: 100,808,394		probably null	Het
Tas2r126	T	C	6: 42,435,136	I201T	probably benign	Het
Tex44	A	G	1: 86,427,646	T426A	probably benign	Het
Tln2	T	C	9: 67,272,668	D807G	possibly damaging	Het
Tlr9	A	G	9: 106,223,750	N80S	probably benign	Het
Trpm7	A	C	2: 126,830,162	H579Q	probably benign	Het
Ufd1	T	C	16: 18,814,911	S29P	probably damaging	Het
Ugt2a3	G	T	5: 87,325,598	Q487K	probably damaging	Het
Wdr66	T	C	5: 123,287,345	V789A	probably benign	Het
Zfyve9	A	G	4: 108,695,767		probably null	Het

Other mutations in Mga

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Mga	APN	2	119919814	missense	possibly damaging	0.65
IGL00719:Mga	APN	2	119947453	nonsense	probably null
IGL01619:Mga	APN	2	119931828	missense	possibly damaging	0.46
IGL01721:Mga	APN	2	119935239	missense	probably damaging	1.00
IGL01759:Mga	APN	2	119951195	missense	possibly damaging	0.92
IGL01785:Mga	APN	2	119902912	missense	probably damaging	1.00
IGL01786:Mga	APN	2	119902912	missense	probably damaging	1.00
IGL01950:Mga	APN	2	119941654	missense	possibly damaging	0.60
IGL01960:Mga	APN	2	119938657	missense	probably damaging	1.00
IGL02086:Mga	APN	2	119924036	missense	probably damaging	0.99
IGL02364:Mga	APN	2	119964054	missense	possibly damaging	0.66
IGL02602:Mga	APN	2	119931884	missense	possibly damaging	0.66
IGL02751:Mga	APN	2	119947770	missense	possibly damaging	0.82
IGL02794:Mga	APN	2	119946289	missense	possibly damaging	0.84
IGL03247:Mga	APN	2	119935513	missense	possibly damaging	0.81
IGL03303:Mga	APN	2	119903452	missense	probably damaging	1.00
PIT4515001:Mga	UTSW	2	119916504	missense	probably damaging	1.00
R0060:Mga	UTSW	2	119960961	critical splice donor site	probably null
R0060:Mga	UTSW	2	119960961	critical splice donor site	probably null
R0417:Mga	UTSW	2	119902790	missense	probably damaging	0.99
R0449:Mga	UTSW	2	119941381	missense	probably damaging	1.00
R0457:Mga	UTSW	2	119916488	missense	probably damaging	0.98
R0538:Mga	UTSW	2	119919706	critical splice donor site	probably null
R0568:Mga	UTSW	2	119935422	missense	probably damaging	1.00
R0614:Mga	UTSW	2	119964466	missense	probably damaging	1.00
R0671:Mga	UTSW	2	119919910	splice site	probably null
R0811:Mga	UTSW	2	119947961	missense	probably damaging	0.99
R0812:Mga	UTSW	2	119947961	missense	probably damaging	0.99
R0948:Mga	UTSW	2	119941659	missense	possibly damaging	0.77
R1177:Mga	UTSW	2	119926446	missense	probably damaging	1.00
R1445:Mga	UTSW	2	119902698	missense	probably damaging	1.00
R1476:Mga	UTSW	2	119941675	missense	probably damaging	0.96
R1583:Mga	UTSW	2	119963960	missense	possibly damaging	0.66
R1592:Mga	UTSW	2	119964666	missense	possibly damaging	0.93
R1627:Mga	UTSW	2	119964562	missense	probably damaging	1.00
R1658:Mga	UTSW	2	119941689	missense	possibly damaging	0.63
R1677:Mga	UTSW	2	119960852	missense	possibly damaging	0.92
R1887:Mga	UTSW	2	119923617	missense	probably damaging	1.00
R1908:Mga	UTSW	2	119926594	missense	possibly damaging	0.66
R1909:Mga	UTSW	2	119926594	missense	possibly damaging	0.66
R2061:Mga	UTSW	2	119964980	unclassified	probably benign
R2145:Mga	UTSW	2	119964157	missense	possibly damaging	0.85
R2159:Mga	UTSW	2	119919643	missense	probably damaging	0.96
R2179:Mga	UTSW	2	119960442	missense	probably damaging	0.99
R2281:Mga	UTSW	2	119903723	missense	probably benign
R2423:Mga	UTSW	2	119964793	missense	probably damaging	1.00
R3620:Mga	UTSW	2	119916668	missense	probably damaging	1.00
R3622:Mga	UTSW	2	119941764	missense	probably damaging	1.00
R3624:Mga	UTSW	2	119941764	missense	probably damaging	1.00
R3802:Mga	UTSW	2	119947339	missense	probably damaging	0.96
R4011:Mga	UTSW	2	119931780	missense	probably damaging	1.00
R4065:Mga	UTSW	2	119947002	missense	probably damaging	1.00
R4520:Mga	UTSW	2	119948098	missense	possibly damaging	0.85
R4649:Mga	UTSW	2	119941493	missense	possibly damaging	0.81
R4660:Mga	UTSW	2	119938623	intron	probably benign
R4757:Mga	UTSW	2	119903639	missense	possibly damaging	0.82
R4771:Mga	UTSW	2	119964294	missense	probably damaging	1.00
R4784:Mga	UTSW	2	119903057	missense	probably damaging	1.00
R4866:Mga	UTSW	2	119964054	missense	possibly damaging	0.66
R4900:Mga	UTSW	2	119964054	missense	possibly damaging	0.66
R4952:Mga	UTSW	2	119903301	missense	probably damaging	1.00
R4995:Mga	UTSW	2	119932582	nonsense	probably null
R5020:Mga	UTSW	2	119951173	nonsense	probably null
R5082:Mga	UTSW	2	119903344	missense	probably damaging	0.98
R5208:Mga	UTSW	2	119947981	missense	possibly damaging	0.83
R5454:Mga	UTSW	2	119903329	missense	probably damaging	0.99
R5466:Mga	UTSW	2	119902697	missense	probably damaging	1.00
R5484:Mga	UTSW	2	119916626	missense	possibly damaging	0.58
R5669:Mga	UTSW	2	119903426	missense	probably damaging	1.00
R5819:Mga	UTSW	2	119941263	missense	possibly damaging	0.61
R5916:Mga	UTSW	2	119964312	missense	probably benign	0.27
R5942:Mga	UTSW	2	119946959	missense	probably benign	0.41
R6305:Mga	UTSW	2	119947698	missense	probably benign	0.00
R6434:Mga	UTSW	2	119923938	missense	probably damaging	0.99
R6467:Mga	UTSW	2	119946295	missense	probably damaging	1.00
R6488:Mga	UTSW	2	119960907	missense	probably damaging	1.00
R6630:Mga	UTSW	2	119923659	missense	probably damaging	0.99
R6790:Mga	UTSW	2	119923754	missense	probably damaging	0.99
R7029:Mga	UTSW	2	119923550	missense	probably damaging	1.00
R7039:Mga	UTSW	2	119932678	missense	probably benign	0.28
R7088:Mga	UTSW	2	119961936	missense	probably damaging	1.00
R7195:Mga	UTSW	2	119917328	missense	probably damaging	1.00
R7273:Mga	UTSW	2	119935214	missense	probably damaging	1.00
R7286:Mga	UTSW	2	119964788	missense	possibly damaging	0.93
R7346:Mga	UTSW	2	119935527	missense	possibly damaging	0.56
R7383:Mga	UTSW	2	119960340	missense	probably damaging	0.99
R7469:Mga	UTSW	2	119903046	missense	probably damaging	1.00
R7484:Mga	UTSW	2	119946229	missense	probably damaging	0.99
R7537:Mga	UTSW	2	119935551	missense	probably damaging	0.97
R7781:Mga	UTSW	2	119917357	missense	probably damaging	1.00
R7921:Mga	UTSW	2	119919678	missense	probably damaging	1.00
R8165:Mga	UTSW	2	119947238	missense	probably benign	0.12
R8226:Mga	UTSW	2	119960385	missense	probably benign	0.33
R8305:Mga	UTSW	2	119946319	missense	possibly damaging	0.77
R8309:Mga	UTSW	2	119960930	missense	probably damaging	1.00
R8363:Mga	UTSW	2	119963926	missense	probably benign	0.43
R8388:Mga	UTSW	2	119964081	missense	probably benign	0.00
R8524:Mga	UTSW	2	119941516	missense	probably damaging	0.97
R8693:Mga	UTSW	2	119963926	missense	possibly damaging	0.65
R8837:Mga	UTSW	2	119938791	splice site	probably benign
R8916:Mga	UTSW	2	119958338	missense	possibly damaging	0.92
R8936:Mga	UTSW	2	119964228	missense	probably damaging	1.00
R9028:Mga	UTSW	2	119947589	missense	probably benign
R9145:Mga	UTSW	2	119964012	missense	probably benign
R9155:Mga	UTSW	2	119926532	missense	probably damaging	1.00
R9308:Mga	UTSW	2	119923888	missense	possibly damaging	0.91
R9342:Mga	UTSW	2	119948175	missense	probably benign
R9347:Mga	UTSW	2	119903037	missense	probably damaging	1.00
R9390:Mga	UTSW	2	119963851	missense	probably damaging	0.99
R9408:Mga	UTSW	2	119935518	missense	possibly damaging	0.92
R9488:Mga	UTSW	2	119964823	missense	possibly damaging	0.90
R9495:Mga	UTSW	2	119951195	missense	possibly damaging	0.92
R9521:Mga	UTSW	2	119964498	missense	probably damaging	0.99
R9780:Mga	UTSW	2	119916772	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- gcccTGAAACTTGGCTCTTGAATTG -3'
(R):5'- ACTGTCATGTATTCTTTCCGTGCTACTG -3'

Sequencing Primer
(F):5'- AAGAACTGTTTTTCCTTCTCTGAG -3'
(R):5'- GCTTTTCGTGACAGCACAG -3'

Posted On

2014-04-13