Incidental Mutation 'R1527:Eps8l1'
ID166286
Institutional Source Beutler Lab
Gene Symbol Eps8l1
Ensembl Gene ENSMUSG00000006154
Gene NameEPS8-like 1
Synonyms4632407K17Rik, 2310051G19Rik, DRC3, EPS8R1
MMRRC Submission 039567-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1527 (G1)
Quality Score155
Status Not validated
Chromosome7
Chromosomal Location4460674-4480487 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4471394 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 288 (D288G)
Ref Sequence ENSEMBL: ENSMUSP00000133206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086372] [ENSMUST00000163137] [ENSMUST00000163804] [ENSMUST00000163893] [ENSMUST00000167298] [ENSMUST00000167810] [ENSMUST00000169820] [ENSMUST00000170635] [ENSMUST00000171445]
Predicted Effect probably benign
Transcript: ENSMUST00000086372
AA Change: D227G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083559
Gene: ENSMUSG00000006154
AA Change: D227G

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146199
Predicted Effect probably benign
Transcript: ENSMUST00000163137
SMART Domains Protein: ENSMUSP00000131345
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 100 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163804
Predicted Effect probably benign
Transcript: ENSMUST00000163893
AA Change: D227G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125840
Gene: ENSMUSG00000006154
AA Change: D227G

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167068
Predicted Effect probably benign
Transcript: ENSMUST00000167298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167599
Predicted Effect probably benign
Transcript: ENSMUST00000167810
SMART Domains Protein: ENSMUSP00000126720
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 152 5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169820
SMART Domains Protein: ENSMUSP00000131773
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 93 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170423
Predicted Effect probably benign
Transcript: ENSMUST00000170635
SMART Domains Protein: ENSMUSP00000127999
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
PDB:2CY5|A 26 52 3e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171445
AA Change: D288G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133206
Gene: ENSMUSG00000006154
AA Change: D288G

DomainStartEndE-ValueType
Pfam:PTB 96 226 5.8e-46 PFAM
low complexity region 343 365 N/A INTRINSIC
SH3 541 596 2.62e-11 SMART
low complexity region 615 625 N/A INTRINSIC
PDB:1WWU|A 693 759 1e-19 PDB
low complexity region 762 776 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171665
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. At least two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,598,269 C130F probably damaging Het
4933402N03Rik T C 7: 131,138,860 D209G probably benign Het
Adam7 A G 14: 68,501,521 V744A probably benign Het
Atr G T 9: 95,870,043 R571I possibly damaging Het
C5ar1 A G 7: 16,248,193 Y301H probably damaging Het
Cacna1d A G 14: 30,107,796 I954T probably damaging Het
Ccdc157 A G 11: 4,151,795 F42S probably damaging Het
Chd2 A T 7: 73,490,614 L622* probably null Het
Csmd3 T C 15: 47,948,087 T1203A probably benign Het
Cxcl17 A G 7: 25,402,211 V67A possibly damaging Het
Ddx4 T C 13: 112,622,239 T263A possibly damaging Het
Fam208a T C 14: 27,480,093 probably null Het
Fbxl4 A G 4: 22,386,154 K254E probably benign Het
Glis1 T C 4: 107,567,926 S245P probably damaging Het
Gm11111 T C 5: 98,553,528 probably benign Het
Haus3 A T 5: 34,154,053 H544Q probably benign Het
Hmcn1 A G 1: 150,773,803 V644A probably benign Het
Lmo7 T C 14: 101,876,828 L2P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mga A G 2: 119,916,597 T410A probably damaging Het
Mical3 T C 6: 121,024,779 D584G probably damaging Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Mroh1 A G 15: 76,452,263 D1553G probably benign Het
Myof T C 19: 37,924,619 Y1462C probably damaging Het
Notch4 T C 17: 34,565,744 C144R probably damaging Het
Obox1 T C 7: 15,555,325 V55A probably damaging Het
Olfr1241 C T 2: 89,482,532 G201D probably benign Het
Olfr761 T A 17: 37,952,829 H65L possibly damaging Het
Olfr822 T A 10: 130,075,192 S261T probably damaging Het
Pclo T C 5: 14,679,648 probably benign Het
Prr14l C T 5: 32,827,949 V1401I possibly damaging Het
Rad51ap1 T C 6: 126,928,167 probably null Het
Rev3l T A 10: 39,822,822 V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgsm2 A T 11: 74,853,848 C848* probably null Het
Slc39a10 A T 1: 46,819,262 V625E probably benign Het
Spry4 C T 18: 38,590,577 M44I probably benign Het
Stat5b A T 11: 100,808,394 probably null Het
Tas2r126 T C 6: 42,435,136 I201T probably benign Het
Tex44 A G 1: 86,427,646 T426A probably benign Het
Tln2 T C 9: 67,272,668 D807G possibly damaging Het
Tlr9 A G 9: 106,223,750 N80S probably benign Het
Trpm7 A C 2: 126,830,162 H579Q probably benign Het
Ufd1 T C 16: 18,814,911 S29P probably damaging Het
Ugt2a3 G T 5: 87,325,598 Q487K probably damaging Het
Wdr66 T C 5: 123,287,345 V789A probably benign Het
Zfyve9 A G 4: 108,695,767 probably null Het
Other mutations in Eps8l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Eps8l1 APN 7 4478920 utr 3 prime probably benign
IGL01455:Eps8l1 APN 7 4478923 utr 3 prime probably benign
IGL01872:Eps8l1 APN 7 4472296 splice site probably benign
IGL02343:Eps8l1 APN 7 4472124 missense probably benign 0.04
IGL02585:Eps8l1 APN 7 4469213 missense probably damaging 1.00
IGL02596:Eps8l1 APN 7 4470872 missense probably damaging 0.99
IGL02673:Eps8l1 APN 7 4478732 missense probably damaging 1.00
IGL03117:Eps8l1 APN 7 4470887 missense probably damaging 1.00
Anamnestic UTSW 7 4470874 missense probably damaging 0.98
souvenir UTSW 7 4477896 missense possibly damaging 0.56
PIT4142001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4151001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4480001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
R0015:Eps8l1 UTSW 7 4477557 splice site probably benign
R0599:Eps8l1 UTSW 7 4477957 missense possibly damaging 0.90
R0686:Eps8l1 UTSW 7 4477450 missense probably benign 0.36
R0827:Eps8l1 UTSW 7 4477389 missense possibly damaging 0.86
R1015:Eps8l1 UTSW 7 4469933 missense probably damaging 1.00
R1447:Eps8l1 UTSW 7 4474056 missense probably damaging 1.00
R1490:Eps8l1 UTSW 7 4470889 missense probably damaging 1.00
R1553:Eps8l1 UTSW 7 4477449 missense probably damaging 0.98
R1763:Eps8l1 UTSW 7 4471823 missense probably benign 0.43
R1863:Eps8l1 UTSW 7 4465360 utr 5 prime probably benign
R2357:Eps8l1 UTSW 7 4470355 missense probably benign 0.06
R3153:Eps8l1 UTSW 7 4471799 missense probably damaging 1.00
R4082:Eps8l1 UTSW 7 4470798 splice site probably null
R4539:Eps8l1 UTSW 7 4478624 missense probably damaging 1.00
R4684:Eps8l1 UTSW 7 4473945 missense probably damaging 0.99
R4930:Eps8l1 UTSW 7 4460916 missense possibly damaging 0.66
R4931:Eps8l1 UTSW 7 4471241 missense possibly damaging 0.95
R5245:Eps8l1 UTSW 7 4470874 missense probably damaging 0.98
R5247:Eps8l1 UTSW 7 4470402 missense probably damaging 1.00
R5305:Eps8l1 UTSW 7 4477896 missense possibly damaging 0.56
R5420:Eps8l1 UTSW 7 4470161 splice site probably null
R5620:Eps8l1 UTSW 7 4460946 missense possibly damaging 0.83
R5705:Eps8l1 UTSW 7 4470035 missense probably benign 0.00
R6063:Eps8l1 UTSW 7 4471297 missense possibly damaging 0.56
R6909:Eps8l1 UTSW 7 4469900 nonsense probably null
R7096:Eps8l1 UTSW 7 4474191 missense probably benign 0.01
R7136:Eps8l1 UTSW 7 4477404 missense probably damaging 1.00
R7144:Eps8l1 UTSW 7 4472185 missense probably damaging 1.00
R7381:Eps8l1 UTSW 7 4470438 splice site probably null
R7539:Eps8l1 UTSW 7 4470037 missense probably damaging 1.00
R7784:Eps8l1 UTSW 7 4472122 missense probably damaging 1.00
R7833:Eps8l1 UTSW 7 4468867 missense possibly damaging 0.76
R8190:Eps8l1 UTSW 7 4471298 missense probably benign 0.05
R8311:Eps8l1 UTSW 7 4471818 missense probably damaging 1.00
R8549:Eps8l1 UTSW 7 4470854 missense probably damaging 1.00
X0060:Eps8l1 UTSW 7 4470851 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATGCCCAGCCTTCGTTTGACC -3'
(R):5'- ACGTGCCACGTTCCTGAATCTC -3'

Sequencing Primer
(F):5'- TTTTCTTAACTCAGGGCGACG -3'
(R):5'- GAATCTCGTTCCCCACTCCAAG -3'
Posted On2014-04-13