Incidental Mutation 'R1527:Cxcl17'
ID166289
Institutional Source Beutler Lab
Gene Symbol Cxcl17
Ensembl Gene ENSMUSG00000060188
Gene Namechemokine (C-X-C motif) ligand 17
Synonyms
MMRRC Submission 039567-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1527 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25400053-25412886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25402211 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 67 (V67A)
Ref Sequence ENSEMBL: ENSMUSP00000073687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074040] [ENSMUST00000105177] [ENSMUST00000149349] [ENSMUST00000200880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074040
AA Change: V67A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073687
Gene: ENSMUSG00000060188
AA Change: V67A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CXCL17 23 126 2.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105177
SMART Domains Protein: ENSMUSP00000100811
Gene: ENSMUSG00000003123

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149349
SMART Domains Protein: ENSMUSP00000123485
Gene: ENSMUSG00000003123

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Pfam:HSL_N 319 627 1.2e-116 PFAM
Pfam:DUF2424 616 774 1.2e-8 PFAM
Pfam:Abhydrolase_3 658 817 1.9e-34 PFAM
low complexity region 881 896 N/A INTRINSIC
Pfam:Abhydrolase_3 951 1041 2.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200880
AA Change: V67A

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144096
Gene: ENSMUSG00000060188
AA Change: V67A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CXCL17 23 111 2.8e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206436
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mucosal chemokine that attracts immature dendritic cells and blood monocytes to the lungs. The encoded protein also promotes tumorigenesis through an angiogenic activity. Finally, this protein exhibits strong antimicrobial activity against E. coli, S. aureus, Salmonella, P. aeruginosa, and C. albicans. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,598,269 C130F probably damaging Het
4933402N03Rik T C 7: 131,138,860 D209G probably benign Het
Adam7 A G 14: 68,501,521 V744A probably benign Het
Atr G T 9: 95,870,043 R571I possibly damaging Het
C5ar1 A G 7: 16,248,193 Y301H probably damaging Het
Cacna1d A G 14: 30,107,796 I954T probably damaging Het
Ccdc157 A G 11: 4,151,795 F42S probably damaging Het
Chd2 A T 7: 73,490,614 L622* probably null Het
Csmd3 T C 15: 47,948,087 T1203A probably benign Het
Ddx4 T C 13: 112,622,239 T263A possibly damaging Het
Eps8l1 A G 7: 4,471,394 D288G probably benign Het
Fam208a T C 14: 27,480,093 probably null Het
Fbxl4 A G 4: 22,386,154 K254E probably benign Het
Glis1 T C 4: 107,567,926 S245P probably damaging Het
Gm11111 T C 5: 98,553,528 probably benign Het
Haus3 A T 5: 34,154,053 H544Q probably benign Het
Hmcn1 A G 1: 150,773,803 V644A probably benign Het
Lmo7 T C 14: 101,876,828 L2P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mga A G 2: 119,916,597 T410A probably damaging Het
Mical3 T C 6: 121,024,779 D584G probably damaging Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Mroh1 A G 15: 76,452,263 D1553G probably benign Het
Myof T C 19: 37,924,619 Y1462C probably damaging Het
Notch4 T C 17: 34,565,744 C144R probably damaging Het
Obox1 T C 7: 15,555,325 V55A probably damaging Het
Olfr1241 C T 2: 89,482,532 G201D probably benign Het
Olfr761 T A 17: 37,952,829 H65L possibly damaging Het
Olfr822 T A 10: 130,075,192 S261T probably damaging Het
Pclo T C 5: 14,679,648 probably benign Het
Prr14l C T 5: 32,827,949 V1401I possibly damaging Het
Rad51ap1 T C 6: 126,928,167 probably null Het
Rev3l T A 10: 39,822,822 V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgsm2 A T 11: 74,853,848 C848* probably null Het
Slc39a10 A T 1: 46,819,262 V625E probably benign Het
Spry4 C T 18: 38,590,577 M44I probably benign Het
Stat5b A T 11: 100,808,394 probably null Het
Tas2r126 T C 6: 42,435,136 I201T probably benign Het
Tex44 A G 1: 86,427,646 T426A probably benign Het
Tln2 T C 9: 67,272,668 D807G possibly damaging Het
Tlr9 A G 9: 106,223,750 N80S probably benign Het
Trpm7 A C 2: 126,830,162 H579Q probably benign Het
Ufd1 T C 16: 18,814,911 S29P probably damaging Het
Ugt2a3 G T 5: 87,325,598 Q487K probably damaging Het
Wdr66 T C 5: 123,287,345 V789A probably benign Het
Zfyve9 A G 4: 108,695,767 probably null Het
Other mutations in Cxcl17
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3772:Cxcl17 UTSW 7 25400329 utr 3 prime probably benign
R5913:Cxcl17 UTSW 7 25402246 nonsense probably null
R7227:Cxcl17 UTSW 7 25402894 missense probably damaging 0.96
R7673:Cxcl17 UTSW 7 25402868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCTAGTTGATGCAGCCTTACC -3'
(R):5'- AGGAGCAGATGCCTACCAAGTCTAC -3'

Sequencing Primer
(F):5'- GATGCAGCCTTACCTCCAC -3'
(R):5'- ccagtcttagcctgatgttcc -3'
Posted On2014-04-13