Mutagenetix > Incidental Mutation

Incidental Mutation 'R1527:Tln2'

166293

Institutional Source

Beutler Lab

Gene Symbol

Tln2

Ensembl Gene

ENSMUSG00000052698

Gene Name

talin 2

Synonyms

MMRRC Submission

039567-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.208) question?

Stock #

R1527 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67217087-67559703 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 67272668 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 807 (D807G)

Ref Sequence

ENSEMBL: ENSMUSP00000149474 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215267] [ENSMUST00000215784] [ENSMUST00000217550]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000039662
AA Change: D1893G

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: D1893G

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	3.4e-59	PFAM
Pfam:I_LWEQ	661	765	1.9e-10	PFAM
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	2.6e-67	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2384	2531	2.5e-52	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000040025
AA Change: D1893G

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: D1893G

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	8.5e-78	PFAM
low complexity region	674	693	N/A	INTRINSIC
internal_repeat_2	703	763	2.05e-7	PROSPERO
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	9.9e-72	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2383	2533	4.3e-51	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214859

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215267
AA Change: D803G

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000215784
AA Change: D1895G

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217550
AA Change: D807G

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110059E24Rik	C	A	19: 21,598,269	C130F	probably damaging	Het
4933402N03Rik	T	C	7: 131,138,860	D209G	probably benign	Het
Adam7	A	G	14: 68,501,521	V744A	probably benign	Het
Atr	G	T	9: 95,870,043	R571I	possibly damaging	Het
C5ar1	A	G	7: 16,248,193	Y301H	probably damaging	Het
Cacna1d	A	G	14: 30,107,796	I954T	probably damaging	Het
Ccdc157	A	G	11: 4,151,795	F42S	probably damaging	Het
Chd2	A	T	7: 73,490,614	L622*	probably null	Het
Csmd3	T	C	15: 47,948,087	T1203A	probably benign	Het
Cxcl17	A	G	7: 25,402,211	V67A	possibly damaging	Het
Ddx4	T	C	13: 112,622,239	T263A	possibly damaging	Het
Eps8l1	A	G	7: 4,471,394	D288G	probably benign	Het
Fam208a	T	C	14: 27,480,093		probably null	Het
Fbxl4	A	G	4: 22,386,154	K254E	probably benign	Het
Glis1	T	C	4: 107,567,926	S245P	probably damaging	Het
Gm11111	T	C	5: 98,553,528		probably benign	Het
Haus3	A	T	5: 34,154,053	H544Q	probably benign	Het
Hmcn1	A	G	1: 150,773,803	V644A	probably benign	Het
Lmo7	T	C	14: 101,876,828	L2P	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Mga	A	G	2: 119,916,597	T410A	probably damaging	Het
Mical3	T	C	6: 121,024,779	D584G	probably damaging	Het
Miga1	A	T	3: 152,317,663	F250L	possibly damaging	Het
Mroh1	A	G	15: 76,452,263	D1553G	probably benign	Het
Myof	T	C	19: 37,924,619	Y1462C	probably damaging	Het
Notch4	T	C	17: 34,565,744	C144R	probably damaging	Het
Obox1	T	C	7: 15,555,325	V55A	probably damaging	Het
Olfr1241	C	T	2: 89,482,532	G201D	probably benign	Het
Olfr761	T	A	17: 37,952,829	H65L	possibly damaging	Het
Olfr822	T	A	10: 130,075,192	S261T	probably damaging	Het
Pclo	T	C	5: 14,679,648		probably benign	Het
Prr14l	C	T	5: 32,827,949	V1401I	possibly damaging	Het
Rad51ap1	T	C	6: 126,928,167		probably null	Het
Rev3l	T	A	10: 39,822,822	V1105D	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sgsm2	A	T	11: 74,853,848	C848*	probably null	Het
Slc39a10	A	T	1: 46,819,262	V625E	probably benign	Het
Spry4	C	T	18: 38,590,577	M44I	probably benign	Het
Stat5b	A	T	11: 100,808,394		probably null	Het
Tas2r126	T	C	6: 42,435,136	I201T	probably benign	Het
Tex44	A	G	1: 86,427,646	T426A	probably benign	Het
Tlr9	A	G	9: 106,223,750	N80S	probably benign	Het
Trpm7	A	C	2: 126,830,162	H579Q	probably benign	Het
Ufd1	T	C	16: 18,814,911	S29P	probably damaging	Het
Ugt2a3	G	T	5: 87,325,598	Q487K	probably damaging	Het
Wdr66	T	C	5: 123,287,345	V789A	probably benign	Het
Zfyve9	A	G	4: 108,695,767		probably null	Het

Other mutations in Tln2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Tln2	APN	9	67344187	missense	possibly damaging	0.59
IGL01110:Tln2	APN	9	67250582	nonsense	probably null
IGL01112:Tln2	APN	9	67311811	missense	probably damaging	1.00
IGL01307:Tln2	APN	9	67395467	missense	probably benign	0.25
IGL01374:Tln2	APN	9	67261923	missense	probably damaging	1.00
IGL01625:Tln2	APN	9	67370623	missense	probably damaging	1.00
IGL01865:Tln2	APN	9	67250614	nonsense	probably null
IGL01999:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02002:Tln2	APN	9	67356698	missense	probably damaging	0.98
IGL02005:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02015:Tln2	APN	9	67361439	splice site	probably benign
IGL02368:Tln2	APN	9	67240810	splice site	probably benign
IGL02444:Tln2	APN	9	67258592	splice site	probably benign
IGL02646:Tln2	APN	9	67255996	missense	probably benign	0.43
IGL02744:Tln2	APN	9	67229376	nonsense	probably null
IGL02869:Tln2	APN	9	67221525	splice site	probably benign
IGL02930:Tln2	APN	9	67393662	nonsense	probably null
IGL03100:Tln2	APN	9	67295737	missense	probably damaging	1.00
IGL03326:Tln2	APN	9	67334257	missense	possibly damaging	0.67
Harrier	UTSW	9	67330552	nonsense	probably null
Marsh	UTSW	9	67272654	missense	probably benign	0.19
BB008:Tln2	UTSW	9	67258460	critical splice donor site	probably null
BB018:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0107:Tln2	UTSW	9	67370706	missense	probably damaging	1.00
R0494:Tln2	UTSW	9	67355197	missense	probably benign	0.22
R0884:Tln2	UTSW	9	67370733	missense	probably damaging	1.00
R0947:Tln2	UTSW	9	67295813	missense	probably benign	0.08
R0989:Tln2	UTSW	9	67229454	missense	probably damaging	1.00
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1486:Tln2	UTSW	9	67311839	missense	probably damaging	1.00
R1584:Tln2	UTSW	9	67296414	missense	probably damaging	1.00
R1636:Tln2	UTSW	9	67306532	missense	probably damaging	1.00
R1656:Tln2	UTSW	9	67227107	missense	possibly damaging	0.81
R1707:Tln2	UTSW	9	67375807	missense	probably benign	0.00
R1749:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1751:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1761:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1767:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1815:Tln2	UTSW	9	67229423	missense	probably damaging	1.00
R1840:Tln2	UTSW	9	67342043	missense	probably damaging	1.00
R1847:Tln2	UTSW	9	67362687	nonsense	probably null
R1964:Tln2	UTSW	9	67342135	missense	probably benign	0.00
R1968:Tln2	UTSW	9	67255901	missense	probably damaging	1.00
R2036:Tln2	UTSW	9	67272704	missense	possibly damaging	0.76
R2038:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R2152:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2153:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2154:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2191:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2192:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2201:Tln2	UTSW	9	67375757	missense	probably damaging	1.00
R3116:Tln2	UTSW	9	67355139	missense	probably benign	0.10
R3151:Tln2	UTSW	9	67330547	critical splice donor site	probably null
R3795:Tln2	UTSW	9	67255915	missense	probably damaging	0.97
R3953:Tln2	UTSW	9	67370629	missense	probably damaging	1.00
R4450:Tln2	UTSW	9	67344065	critical splice donor site	probably null
R4685:Tln2	UTSW	9	67302572	missense	probably damaging	1.00
R4688:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R4696:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4697:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4700:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4701:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4741:Tln2	UTSW	9	67386555	critical splice donor site	probably null
R4806:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4807:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4808:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4967:Tln2	UTSW	9	67355125	missense	probably damaging	0.97
R5061:Tln2	UTSW	9	67354468	missense	probably benign
R5092:Tln2	UTSW	9	67256028	missense	probably benign	0.13
R5093:Tln2	UTSW	9	67334314	missense	probably benign	0.44
R5126:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R5204:Tln2	UTSW	9	67354482	missense	probably benign	0.00
R5236:Tln2	UTSW	9	67365923	missense	probably damaging	0.99
R5287:Tln2	UTSW	9	67242359	missense	probably damaging	1.00
R5568:Tln2	UTSW	9	67311865	missense	probably damaging	1.00
R5571:Tln2	UTSW	9	67334320	missense	possibly damaging	0.88
R5642:Tln2	UTSW	9	67296358	missense	probably benign	0.01
R5711:Tln2	UTSW	9	67392547	missense	probably benign	0.00
R5776:Tln2	UTSW	9	67258250	missense	probably damaging	1.00
R5791:Tln2	UTSW	9	67386605	missense	probably damaging	0.98
R5866:Tln2	UTSW	9	67266868	missense	probably damaging	1.00
R5888:Tln2	UTSW	9	67229403	missense	probably damaging	1.00
R5902:Tln2	UTSW	9	67362717	missense	probably benign	0.02
R6106:Tln2	UTSW	9	67323020	missense	probably damaging	0.99
R6175:Tln2	UTSW	9	67224081	missense	probably damaging	1.00
R6385:Tln2	UTSW	9	67278129	missense	probably benign	0.45
R6430:Tln2	UTSW	9	67272665	missense	probably damaging	1.00
R6441:Tln2	UTSW	9	67272689	missense	probably damaging	1.00
R6738:Tln2	UTSW	9	67386664	missense	possibly damaging	0.91
R6776:Tln2	UTSW	9	67262905	missense	probably damaging	1.00
R6794:Tln2	UTSW	9	67286558	missense	probably benign	0.07
R6850:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R6907:Tln2	UTSW	9	67397635	missense	probably damaging	0.98
R6909:Tln2	UTSW	9	67392532	missense	probably damaging	0.97
R6951:Tln2	UTSW	9	67258485	missense	probably damaging	0.97
R7015:Tln2	UTSW	9	67362647	missense	possibly damaging	0.55
R7051:Tln2	UTSW	9	67346417	missense	probably benign	0.00
R7246:Tln2	UTSW	9	67262979	missense	probably damaging	1.00
R7292:Tln2	UTSW	9	67346461	missense	probably benign
R7753:Tln2	UTSW	9	67395473	missense	probably damaging	1.00
R7868:Tln2	UTSW	9	67348226	missense	probably damaging	1.00
R7931:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R8023:Tln2	UTSW	9	67224064	missense	probably damaging	1.00
R8081:Tln2	UTSW	9	67356747	missense	probably damaging	1.00
R8164:Tln2	UTSW	9	67319420	missense	probably benign	0.31
R8192:Tln2	UTSW	9	67346529	nonsense	probably null
R8495:Tln2	UTSW	9	67354467	missense	probably benign	0.01
R8734:Tln2	UTSW	9	67272654	missense	probably benign	0.19
R8739:Tln2	UTSW	9	67258273	missense	probably damaging	1.00
R8757:Tln2	UTSW	9	67367218	missense	probably damaging	1.00
R8759:Tln2	UTSW	9	67367218	missense	probably damaging	1.00
R8770:Tln2	UTSW	9	67323022	missense	probably benign
R8781:Tln2	UTSW	9	67255951	missense	probably damaging	1.00
R8812:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8814:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8816:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8816:Tln2	UTSW	9	67221517	missense	probably damaging	1.00
R8833:Tln2	UTSW	9	67221411	missense	possibly damaging	0.75
R8835:Tln2	UTSW	9	67397693	splice site	probably benign
R8837:Tln2	UTSW	9	67250584	missense	probably damaging	0.99
R8843:Tln2	UTSW	9	67395545	missense	probably damaging	1.00
R8864:Tln2	UTSW	9	67330552	nonsense	probably null
R8867:Tln2	UTSW	9	67330550	missense	probably damaging	0.98
R8921:Tln2	UTSW	9	67266823	missense	probably damaging	0.99
R9080:Tln2	UTSW	9	67346561	missense	probably damaging	1.00
R9083:Tln2	UTSW	9	67362645	missense	probably damaging	0.96
R9150:Tln2	UTSW	9	67221496	missense	probably damaging	1.00
R9287:Tln2	UTSW	9	67370698	missense	probably benign	0.20
R9330:Tln2	UTSW	9	67321931	missense	possibly damaging	0.61
R9343:Tln2	UTSW	9	67323071	missense	probably benign	0.10
R9355:Tln2	UTSW	9	67355247	missense	possibly damaging	0.46
R9383:Tln2	UTSW	9	67370761	missense	probably benign	0.17
R9386:Tln2	UTSW	9	67365967	missense	possibly damaging	0.78
R9407:Tln2	UTSW	9	67229450	missense	probably damaging	1.00
R9483:Tln2	UTSW	9	67392487	missense	probably damaging	1.00
R9523:Tln2	UTSW	9	67258484	missense	probably damaging	0.99
R9642:Tln2	UTSW	9	67250544	missense	probably benign	0.02
R9703:Tln2	UTSW	9	67386656	missense	probably damaging	1.00
X0027:Tln2	UTSW	9	67376853	missense	probably damaging	1.00
X0064:Tln2	UTSW	9	67348138	missense	probably damaging	1.00
X0067:Tln2	UTSW	9	67370691	missense	probably damaging	1.00
Z1176:Tln2	UTSW	9	67346485	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- ATGAAACCTGCTCCTGGCTCTTG -3'
(R):5'- CAGCATGGGCTTCGCTTGAATTG -3'

Sequencing Primer
(F):5'- GCTCTTGGGCTGGGGTC -3'
(R):5'- AGTGTCCAGCCATTATGCTAGG -3'

Posted On

2014-04-13