Incidental Mutation 'R1527:Atr'
ID166294
Institutional Source Beutler Lab
Gene Symbol Atr
Ensembl Gene ENSMUSG00000032409
Gene Nameataxia telangiectasia and Rad3 related
Synonyms
MMRRC Submission 039567-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1527 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location95857597-95951781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 95870043 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Isoleucine at position 571 (R571I)
Ref Sequence ENSEMBL: ENSMUSP00000034980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034980] [ENSMUST00000215311]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034980
AA Change: R571I

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034980
Gene: ENSMUSG00000032409
AA Change: R571I

DomainStartEndE-ValueType
low complexity region 431 449 N/A INTRINSIC
low complexity region 889 897 N/A INTRINSIC
low complexity region 998 1013 N/A INTRINSIC
UME 1119 1225 2.3e-43 SMART
low complexity region 1352 1362 N/A INTRINSIC
Pfam:FAT 1771 2092 9.2e-51 PFAM
PI3Kc 2320 2630 7.51e-124 SMART
FATC 2609 2641 6.22e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191269
Predicted Effect possibly damaging
Transcript: ENSMUST00000215311
AA Change: R571I

PolyPhen 2 Score 0.578 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs the PI3/PI4-kinase family, and is most closely related to ATM, a protein kinase encoded by the gene mutated in ataxia telangiectasia. This protein and ATM share similarity with Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This kinase has been shown to phosphorylate checkpoint kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor suppressor protein BRCA1. Mutations of this gene are associated with Seckel syndrome. An alternatively spliced transcript variant of this gene has been reported, however, its full length nature is not known. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for a knock-out allele exhibit premature death and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,598,269 C130F probably damaging Het
4933402N03Rik T C 7: 131,138,860 D209G probably benign Het
Adam7 A G 14: 68,501,521 V744A probably benign Het
C5ar1 A G 7: 16,248,193 Y301H probably damaging Het
Cacna1d A G 14: 30,107,796 I954T probably damaging Het
Ccdc157 A G 11: 4,151,795 F42S probably damaging Het
Chd2 A T 7: 73,490,614 L622* probably null Het
Csmd3 T C 15: 47,948,087 T1203A probably benign Het
Cxcl17 A G 7: 25,402,211 V67A possibly damaging Het
Ddx4 T C 13: 112,622,239 T263A possibly damaging Het
Eps8l1 A G 7: 4,471,394 D288G probably benign Het
Fam208a T C 14: 27,480,093 probably null Het
Fbxl4 A G 4: 22,386,154 K254E probably benign Het
Glis1 T C 4: 107,567,926 S245P probably damaging Het
Gm11111 T C 5: 98,553,528 probably benign Het
Haus3 A T 5: 34,154,053 H544Q probably benign Het
Hmcn1 A G 1: 150,773,803 V644A probably benign Het
Lmo7 T C 14: 101,876,828 L2P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mga A G 2: 119,916,597 T410A probably damaging Het
Mical3 T C 6: 121,024,779 D584G probably damaging Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Mroh1 A G 15: 76,452,263 D1553G probably benign Het
Myof T C 19: 37,924,619 Y1462C probably damaging Het
Notch4 T C 17: 34,565,744 C144R probably damaging Het
Obox1 T C 7: 15,555,325 V55A probably damaging Het
Olfr1241 C T 2: 89,482,532 G201D probably benign Het
Olfr761 T A 17: 37,952,829 H65L possibly damaging Het
Olfr822 T A 10: 130,075,192 S261T probably damaging Het
Pclo T C 5: 14,679,648 probably benign Het
Prr14l C T 5: 32,827,949 V1401I possibly damaging Het
Rad51ap1 T C 6: 126,928,167 probably null Het
Rev3l T A 10: 39,822,822 V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgsm2 A T 11: 74,853,848 C848* probably null Het
Slc39a10 A T 1: 46,819,262 V625E probably benign Het
Spry4 C T 18: 38,590,577 M44I probably benign Het
Stat5b A T 11: 100,808,394 probably null Het
Tas2r126 T C 6: 42,435,136 I201T probably benign Het
Tex44 A G 1: 86,427,646 T426A probably benign Het
Tln2 T C 9: 67,272,668 D807G possibly damaging Het
Tlr9 A G 9: 106,223,750 N80S probably benign Het
Trpm7 A C 2: 126,830,162 H579Q probably benign Het
Ufd1 T C 16: 18,814,911 S29P probably damaging Het
Ugt2a3 G T 5: 87,325,598 Q487K probably damaging Het
Wdr66 T C 5: 123,287,345 V789A probably benign Het
Zfyve9 A G 4: 108,695,767 probably null Het
Other mutations in Atr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Atr APN 9 95865052 missense probably damaging 1.00
IGL00922:Atr APN 9 95907345 missense probably damaging 0.97
IGL01020:Atr APN 9 95862783 missense probably damaging 1.00
IGL01345:Atr APN 9 95940949 missense probably damaging 1.00
IGL01364:Atr APN 9 95865624 missense probably benign 0.29
IGL01456:Atr APN 9 95950565 missense possibly damaging 0.62
IGL01534:Atr APN 9 95865546 missense probably damaging 0.99
IGL01761:Atr APN 9 95951448 splice site probably benign
IGL01791:Atr APN 9 95921781 missense probably benign 0.05
IGL01831:Atr APN 9 95870754 missense probably benign 0.18
IGL01973:Atr APN 9 95871674 missense probably damaging 1.00
IGL02008:Atr APN 9 95881420 splice site probably benign
IGL02016:Atr APN 9 95927175 missense probably benign 0.09
IGL02035:Atr APN 9 95866682 missense probably benign 0.01
IGL02058:Atr APN 9 95871487 missense probably damaging 0.99
IGL02081:Atr APN 9 95883205 missense probably damaging 1.00
IGL02224:Atr APN 9 95878629 missense probably damaging 0.98
IGL02234:Atr APN 9 95947250 splice site probably benign
IGL02367:Atr APN 9 95899141 nonsense probably null
IGL02621:Atr APN 9 95908400 missense probably benign 0.00
IGL02728:Atr APN 9 95936475 missense probably damaging 1.00
IGL02833:Atr APN 9 95862852 missense probably damaging 1.00
IGL02939:Atr APN 9 95865261 missense probably benign
IGL03107:Atr APN 9 95897730 missense probably benign 0.28
IGL03382:Atr APN 9 95920822 nonsense probably null
PIT4812001:Atr UTSW 9 95910649 missense probably benign 0.41
R0042:Atr UTSW 9 95927356 splice site probably benign
R0042:Atr UTSW 9 95927356 splice site probably benign
R0281:Atr UTSW 9 95937566 missense probably benign 0.26
R0282:Atr UTSW 9 95862798 missense probably benign 0.12
R0512:Atr UTSW 9 95935526 missense probably damaging 0.99
R0547:Atr UTSW 9 95899165 splice site probably benign
R0567:Atr UTSW 9 95865829 missense probably benign 0.00
R0631:Atr UTSW 9 95874777 missense possibly damaging 0.92
R1116:Atr UTSW 9 95867636 nonsense probably null
R1171:Atr UTSW 9 95907323 missense probably damaging 1.00
R1241:Atr UTSW 9 95950636 missense probably benign 0.08
R1345:Atr UTSW 9 95920355 missense probably benign 0.25
R1400:Atr UTSW 9 95862848 missense probably benign 0.32
R1413:Atr UTSW 9 95932442 missense probably damaging 1.00
R1557:Atr UTSW 9 95871449 missense probably damaging 1.00
R1591:Atr UTSW 9 95945385 missense probably damaging 1.00
R1602:Atr UTSW 9 95951557 missense probably damaging 1.00
R1605:Atr UTSW 9 95936463 missense probably damaging 1.00
R1670:Atr UTSW 9 95861456 missense probably benign 0.38
R1709:Atr UTSW 9 95871076 missense probably benign 0.00
R1728:Atr UTSW 9 95897581 missense probably benign 0.01
R1729:Atr UTSW 9 95897581 missense probably benign 0.01
R1739:Atr UTSW 9 95897581 missense probably benign 0.01
R1816:Atr UTSW 9 95866694 missense probably benign 0.00
R1824:Atr UTSW 9 95936421 missense probably damaging 1.00
R1844:Atr UTSW 9 95905817 missense probably benign 0.01
R1857:Atr UTSW 9 95865097 missense probably damaging 1.00
R1858:Atr UTSW 9 95865097 missense probably damaging 1.00
R1866:Atr UTSW 9 95870605 splice site probably null
R1913:Atr UTSW 9 95866733 missense probably benign 0.01
R2042:Atr UTSW 9 95870022 missense probably benign 0.00
R2210:Atr UTSW 9 95907300 missense probably damaging 1.00
R2230:Atr UTSW 9 95920765 missense probably damaging 1.00
R2361:Atr UTSW 9 95871157 missense probably benign 0.41
R2399:Atr UTSW 9 95871599 missense probably benign 0.00
R2431:Atr UTSW 9 95862892 missense probably benign 0.24
R2860:Atr UTSW 9 95874243 missense probably benign 0.07
R2861:Atr UTSW 9 95874243 missense probably benign 0.07
R3019:Atr UTSW 9 95905818 missense possibly damaging 0.52
R3684:Atr UTSW 9 95920400 missense probably damaging 0.96
R4155:Atr UTSW 9 95888124 nonsense probably null
R4295:Atr UTSW 9 95874426 missense probably benign 0.04
R4359:Atr UTSW 9 95951536 missense probably damaging 1.00
R4506:Atr UTSW 9 95865237 missense probably benign 0.21
R4523:Atr UTSW 9 95862863 missense probably damaging 1.00
R4536:Atr UTSW 9 95874418 missense probably benign 0.26
R4588:Atr UTSW 9 95865667 missense probably benign
R4646:Atr UTSW 9 95871197 critical splice donor site probably null
R4702:Atr UTSW 9 95920355 missense possibly damaging 0.92
R4743:Atr UTSW 9 95862792 missense probably benign 0.14
R4782:Atr UTSW 9 95862797 missense probably benign 0.00
R4928:Atr UTSW 9 95907299 missense probably damaging 1.00
R5031:Atr UTSW 9 95865702 missense probably damaging 0.98
R5138:Atr UTSW 9 95937596 missense probably benign 0.15
R5188:Atr UTSW 9 95921725 missense probably benign 0.00
R5219:Atr UTSW 9 95881238 missense probably damaging 0.99
R5307:Atr UTSW 9 95878544 missense probably benign 0.01
R5414:Atr UTSW 9 95870704 missense probably benign 0.00
R5628:Atr UTSW 9 95874226 nonsense probably null
R5664:Atr UTSW 9 95905813 missense probably benign 0.00
R5678:Atr UTSW 9 95951487 nonsense probably null
R5724:Atr UTSW 9 95866588 missense probably damaging 1.00
R5759:Atr UTSW 9 95874402 missense probably benign 0.01
R5763:Atr UTSW 9 95945123 missense probably benign 0.04
R5922:Atr UTSW 9 95903682 missense probably benign 0.00
R6051:Atr UTSW 9 95908369 missense possibly damaging 0.85
R6161:Atr UTSW 9 95865319 missense probably benign
R6171:Atr UTSW 9 95881271 nonsense probably null
R6532:Atr UTSW 9 95908408 missense probably benign
R6774:Atr UTSW 9 95927213 missense probably benign 0.00
R6894:Atr UTSW 9 95927197 missense probably damaging 1.00
R6930:Atr UTSW 9 95866635 missense probably benign 0.21
R7018:Atr UTSW 9 95866694 missense probably benign 0.17
R7056:Atr UTSW 9 95862863 missense probably damaging 1.00
R7103:Atr UTSW 9 95865372 missense probably damaging 0.98
R7154:Atr UTSW 9 95865045 missense probably benign
R7157:Atr UTSW 9 95869900 missense probably benign 0.00
R7188:Atr UTSW 9 95862791 nonsense probably null
R7189:Atr UTSW 9 95862791 nonsense probably null
R7300:Atr UTSW 9 95865370 missense probably benign 0.00
R7337:Atr UTSW 9 95871448 missense probably damaging 1.00
R7584:Atr UTSW 9 95942713 missense probably damaging 1.00
R7602:Atr UTSW 9 95907383 missense possibly damaging 0.64
R7633:Atr UTSW 9 95947118 missense probably damaging 1.00
R7640:Atr UTSW 9 95907293 splice site probably null
R7677:Atr UTSW 9 95885462 missense probably damaging 1.00
R7699:Atr UTSW 9 95875690 nonsense probably null
R7700:Atr UTSW 9 95875690 nonsense probably null
R7790:Atr UTSW 9 95874180 missense probably damaging 1.00
R8027:Atr UTSW 9 95865756 missense probably damaging 0.99
R8147:Atr UTSW 9 95899060 missense probably damaging 1.00
R8204:Atr UTSW 9 95935513 missense
R8306:Atr UTSW 9 95920370 missense
R8462:Atr UTSW 9 95867526 missense probably benign
R8716:Atr UTSW 9 95907415 missense probably benign 0.09
R8748:Atr UTSW 9 95932423 missense probably benign 0.00
R8795:Atr UTSW 9 95867531 missense probably damaging 1.00
X0019:Atr UTSW 9 95940871 missense probably damaging 1.00
Z1088:Atr UTSW 9 95885320 splice site probably null
Z1177:Atr UTSW 9 95888100 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGAGACAGGAGGATTGCCTCTA -3'
(R):5'- GGCCAGTGAAATCAGATGTGGCTT -3'

Sequencing Primer
(F):5'- CAGGAGGATTGCCTCTAGATCAATG -3'
(R):5'- CAGATGTGGCTTAAAACCATATGC -3'
Posted On2014-04-13