Mutagenetix > Incidental Mutation

Incidental Mutation 'R1527:Rev3l'

166296

Institutional Source

Beutler Lab

Gene Symbol

Rev3l

Ensembl Gene

ENSMUSG00000019841

Gene Name

REV3 like, DNA directed polymerase zeta catalytic subunit

Synonyms

Sez4, Rev

MMRRC Submission

039567-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1527 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

39732118-39875211 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 39822822 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 1105 (V1105D)

Ref Sequence

ENSEMBL: ENSMUSP00000131519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000019986
AA Change: V1105D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: V1105D

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	201	1.6e-10	PFAM
low complexity region	494	506	N/A	INTRINSIC
low complexity region	959	969	N/A	INTRINSIC
low complexity region	1042	1057	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3103	8.2e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131186

Predicted Effect

probably benign
Transcript: ENSMUST00000139803

SMART Domains

Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

Domain	Start	End	E-Value	Type
Blast:POLBc	1	369	1e-155	BLAST
POLBc	434	805	4.77e-34	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000164763
AA Change: V1105D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: V1105D

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	200	1.3e-11	PFAM
low complexity region	494	506	N/A	INTRINSIC
Pfam:DUF4683	745	1132	1.7e-162	PFAM
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3102	6.1e-15	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110059E24Rik	C	A	19: 21,598,269	C130F	probably damaging	Het
4933402N03Rik	T	C	7: 131,138,860	D209G	probably benign	Het
Adam7	A	G	14: 68,501,521	V744A	probably benign	Het
Atr	G	T	9: 95,870,043	R571I	possibly damaging	Het
C5ar1	A	G	7: 16,248,193	Y301H	probably damaging	Het
Cacna1d	A	G	14: 30,107,796	I954T	probably damaging	Het
Ccdc157	A	G	11: 4,151,795	F42S	probably damaging	Het
Chd2	A	T	7: 73,490,614	L622*	probably null	Het
Csmd3	T	C	15: 47,948,087	T1203A	probably benign	Het
Cxcl17	A	G	7: 25,402,211	V67A	possibly damaging	Het
Ddx4	T	C	13: 112,622,239	T263A	possibly damaging	Het
Eps8l1	A	G	7: 4,471,394	D288G	probably benign	Het
Fam208a	T	C	14: 27,480,093		probably null	Het
Fbxl4	A	G	4: 22,386,154	K254E	probably benign	Het
Glis1	T	C	4: 107,567,926	S245P	probably damaging	Het
Gm11111	T	C	5: 98,553,528		probably benign	Het
Haus3	A	T	5: 34,154,053	H544Q	probably benign	Het
Hmcn1	A	G	1: 150,773,803	V644A	probably benign	Het
Lmo7	T	C	14: 101,876,828	L2P	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Mga	A	G	2: 119,916,597	T410A	probably damaging	Het
Mical3	T	C	6: 121,024,779	D584G	probably damaging	Het
Miga1	A	T	3: 152,317,663	F250L	possibly damaging	Het
Mroh1	A	G	15: 76,452,263	D1553G	probably benign	Het
Myof	T	C	19: 37,924,619	Y1462C	probably damaging	Het
Notch4	T	C	17: 34,565,744	C144R	probably damaging	Het
Obox1	T	C	7: 15,555,325	V55A	probably damaging	Het
Olfr1241	C	T	2: 89,482,532	G201D	probably benign	Het
Olfr761	T	A	17: 37,952,829	H65L	possibly damaging	Het
Olfr822	T	A	10: 130,075,192	S261T	probably damaging	Het
Pclo	T	C	5: 14,679,648		probably benign	Het
Prr14l	C	T	5: 32,827,949	V1401I	possibly damaging	Het
Rad51ap1	T	C	6: 126,928,167		probably null	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sgsm2	A	T	11: 74,853,848	C848*	probably null	Het
Slc39a10	A	T	1: 46,819,262	V625E	probably benign	Het
Spry4	C	T	18: 38,590,577	M44I	probably benign	Het
Stat5b	A	T	11: 100,808,394		probably null	Het
Tas2r126	T	C	6: 42,435,136	I201T	probably benign	Het
Tex44	A	G	1: 86,427,646	T426A	probably benign	Het
Tln2	T	C	9: 67,272,668	D807G	possibly damaging	Het
Tlr9	A	G	9: 106,223,750	N80S	probably benign	Het
Trpm7	A	C	2: 126,830,162	H579Q	probably benign	Het
Ufd1	T	C	16: 18,814,911	S29P	probably damaging	Het
Ugt2a3	G	T	5: 87,325,598	Q487K	probably damaging	Het
Wdr66	T	C	5: 123,287,345	V789A	probably benign	Het
Zfyve9	A	G	4: 108,695,767		probably null	Het

Other mutations in Rev3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Rev3l	APN	10	39806969	missense	probably benign
IGL00815:Rev3l	APN	10	39859153	missense	possibly damaging	0.79
IGL00964:Rev3l	APN	10	39864806	missense	probably benign	0.39
IGL01765:Rev3l	APN	10	39828265	missense	probably benign	0.00
IGL01792:Rev3l	APN	10	39823340	missense	probably benign
IGL01950:Rev3l	APN	10	39821157	missense	probably damaging	1.00
IGL01963:Rev3l	APN	10	39822737	missense	possibly damaging	0.90
IGL02089:Rev3l	APN	10	39825099	missense	probably damaging	1.00
IGL02288:Rev3l	APN	10	39828216	missense	probably benign
IGL02381:Rev3l	APN	10	39821346	missense	possibly damaging	0.83
IGL02409:Rev3l	APN	10	39821148	missense	possibly damaging	0.75
IGL02434:Rev3l	APN	10	39822591	missense	probably damaging	1.00
IGL02570:Rev3l	APN	10	39848013	missense	possibly damaging	0.68
IGL02581:Rev3l	APN	10	39821281	missense	probably benign	0.10
IGL02654:Rev3l	APN	10	39862734	missense	probably damaging	1.00
IGL02720:Rev3l	APN	10	39822395	nonsense	probably null
IGL02746:Rev3l	APN	10	39824589	missense	probably damaging	0.99
IGL02829:Rev3l	APN	10	39825240	missense	probably damaging	1.00
IGL02961:Rev3l	APN	10	39827945	missense	possibly damaging	0.65
IGL02974:Rev3l	APN	10	39862747	nonsense	probably null
IGL03029:Rev3l	APN	10	39828486	missense	probably benign	0.34
IGL03153:Rev3l	APN	10	39806878	missense	probably damaging	1.00
IGL03172:Rev3l	APN	10	39824790	missense	probably benign	0.10
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0153:Rev3l	UTSW	10	39874128	nonsense	probably null
R0308:Rev3l	UTSW	10	39824894	missense	probably benign	0.09
R0355:Rev3l	UTSW	10	39817286	missense	probably damaging	1.00
R0513:Rev3l	UTSW	10	39828143	missense	probably benign	0.00
R0523:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R0559:Rev3l	UTSW	10	39824487	missense	probably damaging	1.00
R0761:Rev3l	UTSW	10	39874195	missense	probably benign	0.32
R1023:Rev3l	UTSW	10	39832639	missense	probably damaging	1.00
R1159:Rev3l	UTSW	10	39851925	nonsense	probably null
R1398:Rev3l	UTSW	10	39821583	missense	probably benign	0.05
R1478:Rev3l	UTSW	10	39783333	critical splice donor site	probably null
R1517:Rev3l	UTSW	10	39838443	missense	probably benign	0.34
R1635:Rev3l	UTSW	10	39806662	missense	probably damaging	0.98
R1695:Rev3l	UTSW	10	39824615	nonsense	probably null
R1695:Rev3l	UTSW	10	39824616	missense	probably damaging	0.97
R1782:Rev3l	UTSW	10	39799885	missense	probably benign
R1815:Rev3l	UTSW	10	39822871	missense	probably benign	0.41
R1818:Rev3l	UTSW	10	39828424	missense	probably benign	0.05
R2039:Rev3l	UTSW	10	39824444	missense	probably damaging	1.00
R2071:Rev3l	UTSW	10	39824353	missense	probably benign	0.17
R2101:Rev3l	UTSW	10	39828096	missense	probably benign	0.00
R2141:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R2883:Rev3l	UTSW	10	39825156	missense	probably damaging	1.00
R3787:Rev3l	UTSW	10	39846210	missense	probably damaging	0.97
R3910:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3912:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3913:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R4590:Rev3l	UTSW	10	39806933	missense	probably damaging	1.00
R4631:Rev3l	UTSW	10	39828416	missense	probably benign	0.44
R4633:Rev3l	UTSW	10	39846186	missense	probably damaging	1.00
R4707:Rev3l	UTSW	10	39823397	missense	probably damaging	0.99
R4724:Rev3l	UTSW	10	39846806	nonsense	probably null
R4810:Rev3l	UTSW	10	39823725	missense	probably benign	0.01
R4857:Rev3l	UTSW	10	39838459	missense	probably damaging	1.00
R4882:Rev3l	UTSW	10	39821460	missense	possibly damaging	0.89
R4928:Rev3l	UTSW	10	39823985	missense	probably benign	0.30
R4970:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R4977:Rev3l	UTSW	10	39823578	missense	possibly damaging	0.80
R5112:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R5261:Rev3l	UTSW	10	39846729	missense	probably damaging	1.00
R5419:Rev3l	UTSW	10	39824931	missense	possibly damaging	0.95
R5570:Rev3l	UTSW	10	39852075	critical splice donor site	probably null
R5628:Rev3l	UTSW	10	39822967	missense	probably damaging	0.98
R5689:Rev3l	UTSW	10	39794958	missense	probably damaging	1.00
R5781:Rev3l	UTSW	10	39823093	missense	probably benign	0.00
R5829:Rev3l	UTSW	10	39806906	missense	probably damaging	0.97
R5984:Rev3l	UTSW	10	39742689	intron	probably benign
R5990:Rev3l	UTSW	10	39823811	missense	probably benign	0.17
R6054:Rev3l	UTSW	10	39824150	missense	probably benign	0.01
R6171:Rev3l	UTSW	10	39862713	nonsense	probably null
R6220:Rev3l	UTSW	10	39822779	missense	probably damaging	1.00
R6520:Rev3l	UTSW	10	39822702	missense	probably benign	0.06
R6798:Rev3l	UTSW	10	39854763	missense	probably damaging	1.00
R6811:Rev3l	UTSW	10	39830921	nonsense	probably null
R6812:Rev3l	UTSW	10	39823548	missense	probably benign
R6904:Rev3l	UTSW	10	39821481	missense	probably benign
R6905:Rev3l	UTSW	10	39817327	missense	probably benign	0.18
R6938:Rev3l	UTSW	10	39862710	missense	probably damaging	1.00
R7037:Rev3l	UTSW	10	39851975	missense	probably damaging	1.00
R7124:Rev3l	UTSW	10	39822167	nonsense	probably null
R7286:Rev3l	UTSW	10	39823605	missense	probably damaging	0.99
R7385:Rev3l	UTSW	10	39823682	missense	probably benign	0.01
R7575:Rev3l	UTSW	10	39821445	missense	possibly damaging	0.56
R7596:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R7597:Rev3l	UTSW	10	39822884	missense	probably damaging	1.00
R7670:Rev3l	UTSW	10	39836722	missense	probably benign	0.01
R7804:Rev3l	UTSW	10	39823485	missense	probably benign	0.34
R7818:Rev3l	UTSW	10	39823902	missense	possibly damaging	0.54
R7874:Rev3l	UTSW	10	39822495	missense	possibly damaging	0.72
R7991:Rev3l	UTSW	10	39863738	missense	possibly damaging	0.52
R8059:Rev3l	UTSW	10	39843495	missense	probably damaging	1.00
R8174:Rev3l	UTSW	10	39859115	missense	probably damaging	1.00
R8187:Rev3l	UTSW	10	39806697	missense	probably benign
R8299:Rev3l	UTSW	10	39821541	missense	probably benign	0.01
R8352:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8452:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8468:Rev3l	UTSW	10	39827991	missense	probably damaging	0.99
R8487:Rev3l	UTSW	10	39806848	missense	probably damaging	1.00
R8512:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R8554:Rev3l	UTSW	10	39806842	missense	probably benign	0.12
R8702:Rev3l	UTSW	10	39838469	nonsense	probably null
R8848:Rev3l	UTSW	10	39846709	missense	probably damaging	0.99
R8857:Rev3l	UTSW	10	39794969	nonsense	probably null
R8870:Rev3l	UTSW	10	39862790	missense	probably damaging	1.00
R9094:Rev3l	UTSW	10	39824813	missense	probably benign
R9175:Rev3l	UTSW	10	39854768	missense	possibly damaging	0.83
R9286:Rev3l	UTSW	10	39806951	missense	possibly damaging	0.54
R9299:Rev3l	UTSW	10	39848003	missense	probably damaging	1.00
R9307:Rev3l	UTSW	10	39817153	missense	probably benign	0.01
R9337:Rev3l	UTSW	10	39822854	missense	probably benign	0.40
R9342:Rev3l	UTSW	10	39821462	missense	probably benign
R9389:Rev3l	UTSW	10	39822971	missense	possibly damaging	0.47
R9395:Rev3l	UTSW	10	39859223	critical splice donor site	probably null
R9458:Rev3l	UTSW	10	39783251	missense	probably damaging	1.00
R9481:Rev3l	UTSW	10	39825037	missense	probably benign
R9646:Rev3l	UTSW	10	39822444	missense	probably damaging	1.00
R9686:Rev3l	UTSW	10	39867388	missense	possibly damaging	0.67
X0022:Rev3l	UTSW	10	39828607	critical splice donor site	probably null
Z1088:Rev3l	UTSW	10	39824318	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- ACTCTGAGAGCCAAACGCAAGG -3'
(R):5'- TCGACTAGCTTTTCCTACCCGAGG -3'

Sequencing Primer
(F):5'- ATGTCTAAAAAGTTGCCCCCTG -3'
(R):5'- CCCGAGGACTAACAGTCTTAGTG -3'

Posted On

2014-04-13