Incidental Mutation 'R1527:Ccdc157'
ID166298
Institutional Source Beutler Lab
Gene Symbol Ccdc157
Ensembl Gene ENSMUSG00000051427
Gene Namecoiled-coil domain containing 157
Synonyms
MMRRC Submission 039567-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1527 (G1)
Quality Score203
Status Not validated
Chromosome11
Chromosomal Location4141123-4160293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4151795 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 42 (F42S)
Ref Sequence ENSEMBL: ENSMUSP00000091074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093381] [ENSMUST00000101626]
Predicted Effect probably damaging
Transcript: ENSMUST00000093381
AA Change: F42S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091074
Gene: ENSMUSG00000051427
AA Change: F42S

DomainStartEndE-ValueType
low complexity region 76 88 N/A INTRINSIC
low complexity region 321 343 N/A INTRINSIC
low complexity region 385 414 N/A INTRINSIC
SCOP:d1fxkc_ 452 595 4e-5 SMART
low complexity region 639 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101626
SMART Domains Protein: ENSMUSP00000099148
Gene: ENSMUSG00000051427

DomainStartEndE-ValueType
low complexity region 219 241 N/A INTRINSIC
low complexity region 283 312 N/A INTRINSIC
SCOP:d1fxkc_ 350 493 3e-4 SMART
low complexity region 537 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139099
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,598,269 C130F probably damaging Het
4933402N03Rik T C 7: 131,138,860 D209G probably benign Het
Adam7 A G 14: 68,501,521 V744A probably benign Het
Atr G T 9: 95,870,043 R571I possibly damaging Het
C5ar1 A G 7: 16,248,193 Y301H probably damaging Het
Cacna1d A G 14: 30,107,796 I954T probably damaging Het
Chd2 A T 7: 73,490,614 L622* probably null Het
Csmd3 T C 15: 47,948,087 T1203A probably benign Het
Cxcl17 A G 7: 25,402,211 V67A possibly damaging Het
Ddx4 T C 13: 112,622,239 T263A possibly damaging Het
Eps8l1 A G 7: 4,471,394 D288G probably benign Het
Fam208a T C 14: 27,480,093 probably null Het
Fbxl4 A G 4: 22,386,154 K254E probably benign Het
Glis1 T C 4: 107,567,926 S245P probably damaging Het
Gm11111 T C 5: 98,553,528 probably benign Het
Haus3 A T 5: 34,154,053 H544Q probably benign Het
Hmcn1 A G 1: 150,773,803 V644A probably benign Het
Lmo7 T C 14: 101,876,828 L2P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mga A G 2: 119,916,597 T410A probably damaging Het
Mical3 T C 6: 121,024,779 D584G probably damaging Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Mroh1 A G 15: 76,452,263 D1553G probably benign Het
Myof T C 19: 37,924,619 Y1462C probably damaging Het
Notch4 T C 17: 34,565,744 C144R probably damaging Het
Obox1 T C 7: 15,555,325 V55A probably damaging Het
Olfr1241 C T 2: 89,482,532 G201D probably benign Het
Olfr761 T A 17: 37,952,829 H65L possibly damaging Het
Olfr822 T A 10: 130,075,192 S261T probably damaging Het
Pclo T C 5: 14,679,648 probably benign Het
Prr14l C T 5: 32,827,949 V1401I possibly damaging Het
Rad51ap1 T C 6: 126,928,167 probably null Het
Rev3l T A 10: 39,822,822 V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgsm2 A T 11: 74,853,848 C848* probably null Het
Slc39a10 A T 1: 46,819,262 V625E probably benign Het
Spry4 C T 18: 38,590,577 M44I probably benign Het
Stat5b A T 11: 100,808,394 probably null Het
Tas2r126 T C 6: 42,435,136 I201T probably benign Het
Tex44 A G 1: 86,427,646 T426A probably benign Het
Tln2 T C 9: 67,272,668 D807G possibly damaging Het
Tlr9 A G 9: 106,223,750 N80S probably benign Het
Trpm7 A C 2: 126,830,162 H579Q probably benign Het
Ufd1 T C 16: 18,814,911 S29P probably damaging Het
Ugt2a3 G T 5: 87,325,598 Q487K probably damaging Het
Wdr66 T C 5: 123,287,345 V789A probably benign Het
Zfyve9 A G 4: 108,695,767 probably null Het
Other mutations in Ccdc157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Ccdc157 APN 11 4148781 missense probably damaging 1.00
IGL02267:Ccdc157 APN 11 4144035 missense probably benign 0.00
IGL03182:Ccdc157 APN 11 4151832 missense probably damaging 1.00
R0282:Ccdc157 UTSW 11 4146708 missense probably damaging 0.98
R0360:Ccdc157 UTSW 11 4146663 missense probably damaging 0.98
R1349:Ccdc157 UTSW 11 4149056 missense probably benign 0.20
R1691:Ccdc157 UTSW 11 4149030 missense probably benign 0.07
R1932:Ccdc157 UTSW 11 4146549 missense probably damaging 1.00
R2132:Ccdc157 UTSW 11 4150004 missense probably damaging 1.00
R4361:Ccdc157 UTSW 11 4146550 missense probably damaging 0.99
R4754:Ccdc157 UTSW 11 4148994 missense possibly damaging 0.46
R4786:Ccdc157 UTSW 11 4151861 missense probably damaging 1.00
R5314:Ccdc157 UTSW 11 4150078 nonsense probably null
R5564:Ccdc157 UTSW 11 4148765 missense probably damaging 1.00
R5625:Ccdc157 UTSW 11 4151888 missense probably damaging 0.99
R5898:Ccdc157 UTSW 11 4144538 missense probably benign 0.23
R6193:Ccdc157 UTSW 11 4151912 missense probably damaging 1.00
R6936:Ccdc157 UTSW 11 4144030 missense probably benign
R7057:Ccdc157 UTSW 11 4144586 missense probably benign 0.33
R7113:Ccdc157 UTSW 11 4148889 missense possibly damaging 0.94
R7136:Ccdc157 UTSW 11 4148592 missense possibly damaging 0.94
T0975:Ccdc157 UTSW 11 4146246 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAGTAGTGTTCCCGACACACAG -3'
(R):5'- TGGCAGTAGCCACACCACTTTG -3'

Sequencing Primer
(F):5'- CACTCTGAGGCAGACAGGAC -3'
(R):5'- TTGTATGGACAGCCTGCG -3'
Posted On2014-04-13