Incidental Mutation 'R1527:Ufd1'
ID166310
Institutional Source Beutler Lab
Gene Symbol Ufd1
Ensembl Gene ENSMUSG00000005262
Gene Nameubiquitin recognition factor in ER-associated degradation 1
SynonymsUfd1l, Ufd1
MMRRC Submission 039567-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1527 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location18811779-18835261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18814911 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 29 (S29P)
Ref Sequence ENSEMBL: ENSMUSP00000132341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000028] [ENSMUST00000005394] [ENSMUST00000096990] [ENSMUST00000115578] [ENSMUST00000115585] [ENSMUST00000163695] [ENSMUST00000168822] [ENSMUST00000171789] [ENSMUST00000172013]
Predicted Effect probably benign
Transcript: ENSMUST00000000028
SMART Domains Protein: ENSMUSP00000000028
Gene: ENSMUSG00000000028

DomainStartEndE-ValueType
Pfam:CDC45 19 564 1.6e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000005394
AA Change: S29P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005394
Gene: ENSMUSG00000005262
AA Change: S29P

DomainStartEndE-ValueType
Pfam:UFD1 18 194 2.1e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096990
SMART Domains Protein: ENSMUSP00000094753
Gene: ENSMUSG00000000028

DomainStartEndE-ValueType
Pfam:CDC45 18 74 7.9e-24 PFAM
Pfam:CDC45 73 520 4.5e-138 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115578
AA Change: S29P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111241
Gene: ENSMUSG00000005262
AA Change: S29P

DomainStartEndE-ValueType
Pfam:UFD1 19 194 6.1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115585
SMART Domains Protein: ENSMUSP00000111248
Gene: ENSMUSG00000000028

DomainStartEndE-ValueType
Pfam:CDC45 18 136 5.7e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163695
AA Change: S29P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132341
Gene: ENSMUSG00000005262
AA Change: S29P

DomainStartEndE-ValueType
Pfam:UFD1 18 70 3.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168822
Predicted Effect probably damaging
Transcript: ENSMUST00000171789
AA Change: S29P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000172013
AA Change: S29P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128186
Gene: ENSMUSG00000005262
AA Change: S29P

DomainStartEndE-ValueType
PDB:2YUJ|A 11 36 2e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232311
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with two other proteins, nuclear protein localization-4 and valosin-containing protein, and this complex is necessary for the degradation of ubiquitinated proteins. In addition, this complex controls the disassembly of the mitotic spindle and the formation of a closed nuclear envelope after mitosis. Mutations in this gene have been associated with Catch 22 syndrome as well as cardiac and craniofacial defects. Alternative splicing results in multiple transcript variants encoding different isoforms. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice heterozygous for a knock-out allele are viable with no obvious heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,598,269 C130F probably damaging Het
4933402N03Rik T C 7: 131,138,860 D209G probably benign Het
Adam7 A G 14: 68,501,521 V744A probably benign Het
Atr G T 9: 95,870,043 R571I possibly damaging Het
C5ar1 A G 7: 16,248,193 Y301H probably damaging Het
Cacna1d A G 14: 30,107,796 I954T probably damaging Het
Ccdc157 A G 11: 4,151,795 F42S probably damaging Het
Chd2 A T 7: 73,490,614 L622* probably null Het
Csmd3 T C 15: 47,948,087 T1203A probably benign Het
Cxcl17 A G 7: 25,402,211 V67A possibly damaging Het
Ddx4 T C 13: 112,622,239 T263A possibly damaging Het
Eps8l1 A G 7: 4,471,394 D288G probably benign Het
Fam208a T C 14: 27,480,093 probably null Het
Fbxl4 A G 4: 22,386,154 K254E probably benign Het
Glis1 T C 4: 107,567,926 S245P probably damaging Het
Gm11111 T C 5: 98,553,528 probably benign Het
Haus3 A T 5: 34,154,053 H544Q probably benign Het
Hmcn1 A G 1: 150,773,803 V644A probably benign Het
Lmo7 T C 14: 101,876,828 L2P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mga A G 2: 119,916,597 T410A probably damaging Het
Mical3 T C 6: 121,024,779 D584G probably damaging Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Mroh1 A G 15: 76,452,263 D1553G probably benign Het
Myof T C 19: 37,924,619 Y1462C probably damaging Het
Notch4 T C 17: 34,565,744 C144R probably damaging Het
Obox1 T C 7: 15,555,325 V55A probably damaging Het
Olfr1241 C T 2: 89,482,532 G201D probably benign Het
Olfr761 T A 17: 37,952,829 H65L possibly damaging Het
Olfr822 T A 10: 130,075,192 S261T probably damaging Het
Pclo T C 5: 14,679,648 probably benign Het
Prr14l C T 5: 32,827,949 V1401I possibly damaging Het
Rad51ap1 T C 6: 126,928,167 probably null Het
Rev3l T A 10: 39,822,822 V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgsm2 A T 11: 74,853,848 C848* probably null Het
Slc39a10 A T 1: 46,819,262 V625E probably benign Het
Spry4 C T 18: 38,590,577 M44I probably benign Het
Stat5b A T 11: 100,808,394 probably null Het
Tas2r126 T C 6: 42,435,136 I201T probably benign Het
Tex44 A G 1: 86,427,646 T426A probably benign Het
Tln2 T C 9: 67,272,668 D807G possibly damaging Het
Tlr9 A G 9: 106,223,750 N80S probably benign Het
Trpm7 A C 2: 126,830,162 H579Q probably benign Het
Ugt2a3 G T 5: 87,325,598 Q487K probably damaging Het
Wdr66 T C 5: 123,287,345 V789A probably benign Het
Zfyve9 A G 4: 108,695,767 probably null Het
Other mutations in Ufd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ufd1 APN 16 18827718 unclassified probably benign
IGL00944:Ufd1 APN 16 18825031 missense possibly damaging 0.89
IGL01104:Ufd1 APN 16 18814837 missense probably damaging 1.00
IGL01292:Ufd1 APN 16 18821114 missense probably damaging 0.99
IGL03381:Ufd1 APN 16 18825757 missense probably damaging 0.99
R0611:Ufd1 UTSW 16 18814876 missense possibly damaging 0.94
R0730:Ufd1 UTSW 16 18814887 missense probably damaging 0.99
R1755:Ufd1 UTSW 16 18823253 missense probably damaging 1.00
R4078:Ufd1 UTSW 16 18825778 missense possibly damaging 0.86
R4747:Ufd1 UTSW 16 18821082 missense probably damaging 0.98
R5532:Ufd1 UTSW 16 18817930 missense probably damaging 1.00
R6897:Ufd1 UTSW 16 18827100 missense probably benign 0.29
R7303:Ufd1 UTSW 16 18817965 missense probably damaging 0.99
R7348:Ufd1 UTSW 16 18815885 intron probably benign
R7657:Ufd1 UTSW 16 18817963 missense probably benign
R7913:Ufd1 UTSW 16 18814866 missense probably benign 0.01
R7994:Ufd1 UTSW 16 18814866 missense probably benign 0.01
Z1177:Ufd1 UTSW 16 18823283 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGCCGAGGTGGTCAAAAGAACATTC -3'
(R):5'- TCTGGTGCCCACATGCAAACTAAG -3'

Sequencing Primer
(F):5'- ACGCACTGATGACTTGCTATG -3'
(R):5'- CAAACTAAGGGCTATAGAAGGCTAC -3'
Posted On2014-04-13