Mutagenetix > Incidental Mutation

Incidental Mutation 'R1527:Notch4'

166311

Institutional Source

Beutler Lab

Gene Symbol

Notch4

Ensembl Gene

ENSMUSG00000015468

Gene Name

notch 4

Synonyms

Int3, N4, Int-3

MMRRC Submission

039567-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1527 (G1)

Quality Score

220

Status

Not validated

Chromosome

Chromosomal Location

34564268-34588503 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34565744 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 144 (C144R)

Ref Sequence

ENSEMBL: ENSMUSP00000133574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015612] [ENSMUST00000173389]

AlphaFold

P31695

Predicted Effect

probably damaging
Transcript: ENSMUST00000015612
AA Change: C140R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000015612
Gene: ENSMUSG00000015468
AA Change: C140R

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	24	60	3.2e-4	SMART
EGF	64	112	1.07e-5	SMART
EGF	118	152	5.49e-3	SMART
EGF	156	189	9.33e-6	SMART
EGF_CA	191	229	1.42e-10	SMART
EGF	234	271	1.11e-3	SMART
EGF	276	309	1.84e-4	SMART
EGF_CA	311	350	2.52e-11	SMART
EGF_CA	352	388	1.85e-9	SMART
EGF	392	427	1.58e-3	SMART
EGF_CA	429	470	2.46e-14	SMART
EGF_CA	472	508	5.03e-11	SMART
EGF_CA	510	546	6.74e-12	SMART
EGF_CA	548	584	2.98e-13	SMART
EGF_CA	586	622	7.63e-11	SMART
EGF_like	645	686	2.86e1	SMART
EGF	691	724	3.48e-5	SMART
EGF	729	762	3.62e-3	SMART
EGF_CA	764	800	1.48e-8	SMART
EGF	806	839	1.74e-5	SMART
EGF	844	877	2.3e-5	SMART
EGF	881	924	3.59e-7	SMART
EGF_CA	926	962	7.29e-8	SMART
EGF_CA	965	1000	4.42e-7	SMART
EGF_CA	1002	1040	4.56e-9	SMART
EGF	1045	1081	6.16e-6	SMART
EGF	1086	1122	8.65e-1	SMART
EGF	1129	1167	1.45e-2	SMART
NL	1159	1200	6.79e-13	SMART
NL	1203	1242	2.01e-15	SMART
NL	1243	1281	1.85e-14	SMART
NOD	1287	1341	4.37e-8	SMART
NODP	1373	1437	2.12e-6	SMART
transmembrane domain	1441	1463	N/A	INTRINSIC
low complexity region	1525	1539	N/A	INTRINSIC
ANK	1578	1623	2.5e3	SMART
ANK	1628	1657	1.12e-3	SMART
ANK	1661	1691	5.01e-1	SMART
ANK	1695	1724	1.65e-1	SMART
ANK	1728	1757	4.56e-4	SMART
ANK	1761	1790	2.88e-1	SMART
low complexity region	1889	1906	N/A	INTRINSIC
low complexity region	1925	1937	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126950

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152714

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172623

Predicted Effect

probably damaging
Transcript: ENSMUST00000173389
AA Change: C144R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133574
Gene: ENSMUSG00000015468
AA Change: C144R

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	28	64	3.2e-4	SMART
EGF	68	116	1.07e-5	SMART
EGF	122	156	5.49e-3	SMART
EGF	160	193	9.33e-6	SMART
EGF_CA	195	233	1.42e-10	SMART
EGF	238	275	1.11e-3	SMART
EGF	280	313	1.84e-4	SMART
EGF_CA	315	354	2.52e-11	SMART
EGF_CA	356	392	1.85e-9	SMART
EGF	396	431	1.58e-3	SMART
EGF_CA	433	474	2.46e-14	SMART
EGF_CA	476	512	5.03e-11	SMART
EGF_CA	514	550	6.74e-12	SMART
EGF_CA	552	588	2.98e-13	SMART
EGF_CA	590	626	7.63e-11	SMART
EGF_like	649	690	2.86e1	SMART
EGF	695	728	3.48e-5	SMART
EGF	733	766	3.62e-3	SMART
EGF_CA	768	804	1.48e-8	SMART
EGF	810	843	1.74e-5	SMART
EGF	848	881	2.3e-5	SMART
EGF	885	928	3.59e-7	SMART
EGF_like	930	955	7.02e-1	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a slight delay in postnatal retinal angiogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110059E24Rik	C	A	19: 21,598,269	C130F	probably damaging	Het
4933402N03Rik	T	C	7: 131,138,860	D209G	probably benign	Het
Adam7	A	G	14: 68,501,521	V744A	probably benign	Het
Atr	G	T	9: 95,870,043	R571I	possibly damaging	Het
C5ar1	A	G	7: 16,248,193	Y301H	probably damaging	Het
Cacna1d	A	G	14: 30,107,796	I954T	probably damaging	Het
Ccdc157	A	G	11: 4,151,795	F42S	probably damaging	Het
Chd2	A	T	7: 73,490,614	L622*	probably null	Het
Csmd3	T	C	15: 47,948,087	T1203A	probably benign	Het
Cxcl17	A	G	7: 25,402,211	V67A	possibly damaging	Het
Ddx4	T	C	13: 112,622,239	T263A	possibly damaging	Het
Eps8l1	A	G	7: 4,471,394	D288G	probably benign	Het
Fam208a	T	C	14: 27,480,093		probably null	Het
Fbxl4	A	G	4: 22,386,154	K254E	probably benign	Het
Glis1	T	C	4: 107,567,926	S245P	probably damaging	Het
Gm11111	T	C	5: 98,553,528		probably benign	Het
Haus3	A	T	5: 34,154,053	H544Q	probably benign	Het
Hmcn1	A	G	1: 150,773,803	V644A	probably benign	Het
Lmo7	T	C	14: 101,876,828	L2P	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Mga	A	G	2: 119,916,597	T410A	probably damaging	Het
Mical3	T	C	6: 121,024,779	D584G	probably damaging	Het
Miga1	A	T	3: 152,317,663	F250L	possibly damaging	Het
Mroh1	A	G	15: 76,452,263	D1553G	probably benign	Het
Myof	T	C	19: 37,924,619	Y1462C	probably damaging	Het
Obox1	T	C	7: 15,555,325	V55A	probably damaging	Het
Olfr1241	C	T	2: 89,482,532	G201D	probably benign	Het
Olfr761	T	A	17: 37,952,829	H65L	possibly damaging	Het
Olfr822	T	A	10: 130,075,192	S261T	probably damaging	Het
Pclo	T	C	5: 14,679,648		probably benign	Het
Prr14l	C	T	5: 32,827,949	V1401I	possibly damaging	Het
Rad51ap1	T	C	6: 126,928,167		probably null	Het
Rev3l	T	A	10: 39,822,822	V1105D	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sgsm2	A	T	11: 74,853,848	C848*	probably null	Het
Slc39a10	A	T	1: 46,819,262	V625E	probably benign	Het
Spry4	C	T	18: 38,590,577	M44I	probably benign	Het
Stat5b	A	T	11: 100,808,394		probably null	Het
Tas2r126	T	C	6: 42,435,136	I201T	probably benign	Het
Tex44	A	G	1: 86,427,646	T426A	probably benign	Het
Tln2	T	C	9: 67,272,668	D807G	possibly damaging	Het
Tlr9	A	G	9: 106,223,750	N80S	probably benign	Het
Trpm7	A	C	2: 126,830,162	H579Q	probably benign	Het
Ufd1	T	C	16: 18,814,911	S29P	probably damaging	Het
Ugt2a3	G	T	5: 87,325,598	Q487K	probably damaging	Het
Wdr66	T	C	5: 123,287,345	V789A	probably benign	Het
Zfyve9	A	G	4: 108,695,767		probably null	Het

Other mutations in Notch4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Notch4	APN	17	34575561	critical splice donor site	probably null
IGL01022:Notch4	APN	17	34565697	missense	probably damaging	1.00
IGL01356:Notch4	APN	17	34581026	missense	possibly damaging	0.67
IGL01634:Notch4	APN	17	34572588	missense	probably damaging	1.00
IGL02150:Notch4	APN	17	34584613	missense	probably damaging	1.00
IGL02248:Notch4	APN	17	34587198	missense	probably damaging	1.00
IGL02271:Notch4	APN	17	34568471	missense	probably damaging	1.00
IGL02299:Notch4	APN	17	34578004	missense	probably damaging	1.00
IGL02561:Notch4	APN	17	34568160	splice site	probably benign
IGL02604:Notch4	APN	17	34565388	splice site	probably null
IGL03323:Notch4	APN	17	34582471	missense	probably damaging	1.00
IGL03366:Notch4	APN	17	34572568	missense	probably damaging	1.00
IGL03408:Notch4	APN	17	34565568	missense	probably benign	0.03
K3955:Notch4	UTSW	17	34568462	missense	probably damaging	1.00
R0123:Notch4	UTSW	17	34565363	missense	possibly damaging	0.85
R0366:Notch4	UTSW	17	34581499	splice site	probably benign
R0446:Notch4	UTSW	17	34565363	missense	possibly damaging	0.85
R0490:Notch4	UTSW	17	34582890	missense	probably damaging	1.00
R0504:Notch4	UTSW	17	34575091	missense	probably damaging	1.00
R0545:Notch4	UTSW	17	34583433	missense	probably damaging	1.00
R0702:Notch4	UTSW	17	34575203	missense	probably damaging	1.00
R0763:Notch4	UTSW	17	34565332	nonsense	probably null
R0854:Notch4	UTSW	17	34568572	missense	probably damaging	1.00
R1082:Notch4	UTSW	17	34587390	missense	probably damaging	1.00
R1196:Notch4	UTSW	17	34568863	missense	probably damaging	1.00
R1316:Notch4	UTSW	17	34567470	missense	probably damaging	1.00
R1493:Notch4	UTSW	17	34567682	nonsense	probably null
R1548:Notch4	UTSW	17	34568422	missense	probably damaging	1.00
R1718:Notch4	UTSW	17	34576763	splice site	probably benign
R1855:Notch4	UTSW	17	34580962	missense	probably benign	0.05
R1988:Notch4	UTSW	17	34587588	missense	possibly damaging	0.59
R2022:Notch4	UTSW	17	34587528	missense	probably damaging	1.00
R2023:Notch4	UTSW	17	34587528	missense	probably damaging	1.00
R2078:Notch4	UTSW	17	34568715	critical splice acceptor site	probably null
R2369:Notch4	UTSW	17	34585950	missense	probably benign	0.15
R3846:Notch4	UTSW	17	34578097	missense	probably damaging	1.00
R3874:Notch4	UTSW	17	34578069	nonsense	probably null
R4087:Notch4	UTSW	17	34584435	missense	probably damaging	1.00
R4456:Notch4	UTSW	17	34583833	missense	probably damaging	0.99
R4628:Notch4	UTSW	17	34570185	missense	probably damaging	1.00
R4728:Notch4	UTSW	17	34570205	missense	probably benign	0.00
R4778:Notch4	UTSW	17	34582511	missense	possibly damaging	0.95
R4818:Notch4	UTSW	17	34578716	splice site	probably benign
R4828:Notch4	UTSW	17	34570060	missense	probably damaging	1.00
R4830:Notch4	UTSW	17	34570118	missense	probably damaging	1.00
R4859:Notch4	UTSW	17	34587180	missense	probably damaging	1.00
R4871:Notch4	UTSW	17	34577562	missense	possibly damaging	0.63
R5090:Notch4	UTSW	17	34580920	missense	probably damaging	0.99
R5290:Notch4	UTSW	17	34565289	missense	probably benign	0.01
R5363:Notch4	UTSW	17	34587123	missense	probably damaging	1.00
R5860:Notch4	UTSW	17	34582418	missense	probably damaging	1.00
R6352:Notch4	UTSW	17	34567461	missense	probably damaging	1.00
R6385:Notch4	UTSW	17	34573814	missense	probably null	0.16
R6422:Notch4	UTSW	17	34584559	missense	probably benign
R6645:Notch4	UTSW	17	34587816	missense	probably benign	0.00
R6836:Notch4	UTSW	17	34586100	missense	probably damaging	0.96
R6943:Notch4	UTSW	17	34583603	missense	probably benign
R6991:Notch4	UTSW	17	34584800	nonsense	probably null
R7078:Notch4	UTSW	17	34582546	missense	possibly damaging	0.94
R7168:Notch4	UTSW	17	34572693	missense	probably benign	0.05
R7182:Notch4	UTSW	17	34583499	missense	probably damaging	1.00
R7240:Notch4	UTSW	17	34576471	missense	probably benign	0.00
R7247:Notch4	UTSW	17	34572517	missense	probably damaging	1.00
R7556:Notch4	UTSW	17	34575470	missense	probably damaging	1.00
R7571:Notch4	UTSW	17	34583574	missense	probably damaging	0.99
R7697:Notch4	UTSW	17	34570185	missense	probably damaging	1.00
R7763:Notch4	UTSW	17	34582418	missense	probably damaging	1.00
R7994:Notch4	UTSW	17	34578090	missense	possibly damaging	0.82
R8139:Notch4	UTSW	17	34584800	nonsense	probably null
R8171:Notch4	UTSW	17	34582509	nonsense	probably null
R8375:Notch4	UTSW	17	34568254	missense	possibly damaging	0.90
R8448:Notch4	UTSW	17	34586789	splice site	probably null
R8543:Notch4	UTSW	17	34568420	missense	probably damaging	1.00
R8776:Notch4	UTSW	17	34587605	missense	probably damaging	1.00
R8776-TAIL:Notch4	UTSW	17	34587605	missense	probably damaging	1.00
R8847:Notch4	UTSW	17	34584988	splice site	probably benign
R8885:Notch4	UTSW	17	34584496	missense	possibly damaging	0.94
R9126:Notch4	UTSW	17	34581106	missense	probably benign	0.00
R9184:Notch4	UTSW	17	34587390	missense	probably damaging	1.00
R9425:Notch4	UTSW	17	34576827	missense	probably benign	0.42
R9434:Notch4	UTSW	17	34582699	missense	probably damaging	1.00
R9462:Notch4	UTSW	17	34587693	missense	probably benign	0.00
R9664:Notch4	UTSW	17	34565627	missense	probably benign	0.07
R9772:Notch4	UTSW	17	34573909	critical splice donor site	probably null
X0054:Notch4	UTSW	17	34584495	missense	probably damaging	1.00
X0067:Notch4	UTSW	17	34586084	nonsense	probably null
Z1088:Notch4	UTSW	17	34587915	missense	probably damaging	1.00
Z1177:Notch4	UTSW	17	34575148	missense	probably damaging	1.00
Z1177:Notch4	UTSW	17	34587908	missense	probably damaging	0.97
Z1177:Notch4	UTSW	17	34587909	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AGCTGCCAAGCCCTGCTCCC -3'
(R):5'- gcccGACTGTCCCGTTCTTTACTTTT -3'

Sequencing Primer
(F):5'- CTCCCCACACCCCCAAG -3'
(R):5'- gatgagaccaagcaagcaag -3'

Posted On

2014-04-13