Incidental Mutation 'R1528:Zc3h6'
ID 166332
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms 4631426G04Rik, 4833425H18Rik
MMRRC Submission 039568-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R1528 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 128809322-128860483 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 128858989 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 1007 (P1007S)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110320
AA Change: P1007S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: P1007S

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135186
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 78,903,530 (GRCm39) Q262L possibly damaging Het
Abcg4 T C 9: 44,186,020 (GRCm39) Y617C probably damaging Het
Amph G A 13: 19,326,198 (GRCm39) V643M probably damaging Het
Ano1 T G 7: 144,149,303 (GRCm39) S853R probably damaging Het
Ap4e1 T A 2: 126,853,743 (GRCm39) S60R possibly damaging Het
Atp4b C A 8: 13,439,693 (GRCm39) K176N possibly damaging Het
Atxn2 A T 5: 121,940,171 (GRCm39) D982V probably damaging Het
Atxn2 T C 5: 121,951,593 (GRCm39) F646S probably damaging Het
Bcl2l13 T C 6: 120,847,755 (GRCm39) C136R possibly damaging Het
Bltp1 C T 3: 37,106,684 (GRCm39) H5005Y unknown Het
Cacna1i A G 15: 80,275,975 (GRCm39) probably null Het
Ccdc122 T A 14: 77,305,379 (GRCm39) V11D possibly damaging Het
Cdnf A G 2: 3,522,078 (GRCm39) D90G probably damaging Het
Cep104 T G 4: 154,078,965 (GRCm39) V323G probably benign Het
Chmp6 A G 11: 119,807,541 (GRCm39) D128G probably benign Het
Clec18a A T 8: 111,805,498 (GRCm39) M201K probably benign Het
Col11a1 A T 3: 114,010,644 (GRCm39) probably benign Het
Col6a4 A T 9: 105,952,419 (GRCm39) M493K probably damaging Het
Crygd A C 1: 65,102,216 (GRCm39) probably null Het
Dennd1c T C 17: 57,373,935 (GRCm39) T543A probably benign Het
Erbb4 A T 1: 68,117,741 (GRCm39) C891* probably null Het
Ercc5 A T 1: 44,217,401 (GRCm39) K915* probably null Het
Ercc6 A T 14: 32,240,979 (GRCm39) N168Y probably damaging Het
Esrp2 G T 8: 106,863,384 (GRCm39) P6T unknown Het
Exoc1 A G 5: 76,697,411 (GRCm39) K396R possibly damaging Het
Fat3 T A 9: 15,836,387 (GRCm39) Y4039F probably benign Het
Fcsk A T 8: 111,609,873 (GRCm39) L1047Q probably damaging Het
Fgf7 T A 2: 125,877,738 (GRCm39) M35K probably damaging Het
Fras1 G A 5: 96,784,678 (GRCm39) G887D probably damaging Het
Gbp4 A T 5: 105,269,658 (GRCm39) probably null Het
Homez A T 14: 55,095,162 (GRCm39) M182K probably benign Het
Hrnr G A 3: 93,230,101 (GRCm39) S113N possibly damaging Het
Ifit3b T G 19: 34,589,072 (GRCm39) S83A probably benign Het
Ildr2 A G 1: 166,098,064 (GRCm39) probably null Het
Klhdc1 A T 12: 69,309,972 (GRCm39) R291S probably benign Het
Krt77 T A 15: 101,769,523 (GRCm39) I413F probably damaging Het
Lipn A G 19: 34,046,070 (GRCm39) I14M probably damaging Het
Macf1 T G 4: 123,369,807 (GRCm39) R86S probably benign Het
Mroh8 C A 2: 157,071,975 (GRCm39) G510V probably damaging Het
Mycbp2 A T 14: 103,470,033 (GRCm39) D1255E possibly damaging Het
Nckap5 C T 1: 125,952,659 (GRCm39) V1234I possibly damaging Het
Nlrp9c T C 7: 26,081,723 (GRCm39) K668E probably damaging Het
Nod2 T C 8: 89,391,217 (GRCm39) M508T possibly damaging Het
Npffr1 A G 10: 61,450,016 (GRCm39) M97V possibly damaging Het
Nsd3 G A 8: 26,188,795 (GRCm39) V43M probably damaging Het
Nubp2 A G 17: 25,103,388 (GRCm39) V163A probably damaging Het
Oas1e A T 5: 120,926,054 (GRCm39) F338Y probably damaging Het
Oat C A 7: 132,165,998 (GRCm39) G196C probably damaging Het
Or4a69 C T 2: 89,312,897 (GRCm39) G194D probably damaging Het
Or52e8b A T 7: 104,673,971 (GRCm39) L72Q probably damaging Het
Or7a41 T C 10: 78,871,398 (GRCm39) L256P probably damaging Het
P2ry13 T C 3: 59,117,710 (GRCm39) T23A probably benign Het
Phf8-ps A G 17: 33,286,215 (GRCm39) S196P probably damaging Het
Pja2 C A 17: 64,616,217 (GRCm39) S226I possibly damaging Het
Pkhd1l1 T C 15: 44,390,120 (GRCm39) V1412A probably damaging Het
Plekhs1 T C 19: 56,468,427 (GRCm39) S332P probably damaging Het
Polr3e T A 7: 120,539,820 (GRCm39) N522K probably damaging Het
Prdm10 A G 9: 31,268,582 (GRCm39) T844A probably damaging Het
Ripk1 C T 13: 34,212,130 (GRCm39) P480L probably benign Het
Rnf139 T C 15: 58,771,064 (GRCm39) V363A probably damaging Het
Rnf19a A T 15: 36,265,801 (GRCm39) S99T possibly damaging Het
Rnf224 G A 2: 25,126,110 (GRCm39) T81I probably benign Het
Rpgrip1 T C 14: 52,349,681 (GRCm39) L23S probably benign Het
Setd5 T A 6: 113,098,699 (GRCm39) F758L probably damaging Het
Smlr1 C A 10: 25,411,976 (GRCm39) V4L possibly damaging Het
Snx1 T C 9: 66,016,825 (GRCm39) D34G probably damaging Het
Spaca5 A T X: 20,942,892 (GRCm39) T92S probably benign Het
Speer4f2 A G 5: 17,581,540 (GRCm39) T161A Het
Swi5 C A 2: 32,170,716 (GRCm39) probably null Het
Syne2 T A 12: 76,012,874 (GRCm39) D2689E probably benign Het
Tcof1 T A 18: 60,948,071 (GRCm39) K1299* probably null Het
Tmprss11e G A 5: 86,872,069 (GRCm39) T49I probably damaging Het
Tmx3 T A 18: 90,555,210 (GRCm39) V309D possibly damaging Het
Trim30b C G 7: 104,006,506 (GRCm39) V117L possibly damaging Het
Tsen2 C A 6: 115,536,989 (GRCm39) H248Q probably benign Het
Ttn T C 2: 76,567,412 (GRCm39) Y19500C probably damaging Het
Tubgcp2 A G 7: 139,613,696 (GRCm39) probably benign Het
Vwf A C 6: 125,585,254 (GRCm39) D712A possibly damaging Het
Wfdc2 A G 2: 164,407,828 (GRCm39) K166E probably damaging Het
Xrcc2 T C 5: 25,897,292 (GRCm39) D219G probably benign Het
Zdhhc17 A T 10: 110,784,050 (GRCm39) probably null Het
Zfp369 T A 13: 65,439,979 (GRCm39) I221N probably damaging Het
Zfp655 A T 5: 145,181,411 (GRCm39) N423I probably damaging Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 128,853,795 (GRCm39) missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 128,859,298 (GRCm39) missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128,839,605 (GRCm39) missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128,835,146 (GRCm39) missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 128,858,501 (GRCm39) missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 128,857,531 (GRCm39) missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128,839,715 (GRCm39) missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 128,857,332 (GRCm39) missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 128,856,747 (GRCm39) missense probably benign 0.00
R0538:Zc3h6 UTSW 2 128,859,143 (GRCm39) missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 128,848,736 (GRCm39) missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 128,859,056 (GRCm39) missense probably benign 0.00
R1698:Zc3h6 UTSW 2 128,859,278 (GRCm39) missense probably benign
R1712:Zc3h6 UTSW 2 128,858,654 (GRCm39) missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 128,858,540 (GRCm39) missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128,839,715 (GRCm39) missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 128,848,006 (GRCm39) missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 128,857,538 (GRCm39) missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128,809,750 (GRCm39) missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 128,856,629 (GRCm39) missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128,835,122 (GRCm39) missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 128,857,380 (GRCm39) missense probably benign 0.43
R2899:Zc3h6 UTSW 2 128,844,152 (GRCm39) missense probably benign 0.00
R3711:Zc3h6 UTSW 2 128,859,251 (GRCm39) missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128,839,712 (GRCm39) missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 128,858,060 (GRCm39) missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 128,844,160 (GRCm39) missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 128,852,353 (GRCm39) missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 128,859,229 (GRCm39) missense probably benign 0.00
R5125:Zc3h6 UTSW 2 128,856,399 (GRCm39) missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128,835,372 (GRCm39) intron probably benign
R5802:Zc3h6 UTSW 2 128,857,479 (GRCm39) missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128,835,197 (GRCm39) missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128,839,696 (GRCm39) splice site probably null
R5950:Zc3h6 UTSW 2 128,839,710 (GRCm39) nonsense probably null
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 128,857,341 (GRCm39) missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128,835,331 (GRCm39) missense unknown
R7340:Zc3h6 UTSW 2 128,835,110 (GRCm39) missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 128,859,172 (GRCm39) missense probably benign 0.02
R7576:Zc3h6 UTSW 2 128,856,473 (GRCm39) missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 128,857,555 (GRCm39) critical splice donor site probably null
R7924:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 128,858,934 (GRCm39) missense probably benign 0.30
R8877:Zc3h6 UTSW 2 128,856,319 (GRCm39) nonsense probably null
R9076:Zc3h6 UTSW 2 128,859,096 (GRCm39) nonsense probably null
R9577:Zc3h6 UTSW 2 128,858,102 (GRCm39) missense
R9687:Zc3h6 UTSW 2 128,859,281 (GRCm39) missense probably damaging 1.00
R9745:Zc3h6 UTSW 2 128,859,155 (GRCm39) missense probably benign 0.08
Z1176:Zc3h6 UTSW 2 128,858,141 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTGAGCCTTGATCCAACATCAGC -3'
(R):5'- TACTGGCCCATCAACAGGGACTTC -3'

Sequencing Primer
(F):5'- CTTAGAGCAGTCTGGAGACTTACAC -3'
(R):5'- GTGGTACGATCACTTCTCCAGG -3'
Posted On 2014-04-13