Incidental Mutation 'R1528:Vwf'
ID 166356
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene Name Von Willebrand factor
Synonyms B130011O06Rik, 6820430P06Rik
MMRRC Submission 039568-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R1528 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 125529911-125663642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 125585254 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 712 (D712A)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000112254
AA Change: D712A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: D712A

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150548
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 78,903,530 (GRCm39) Q262L possibly damaging Het
Abcg4 T C 9: 44,186,020 (GRCm39) Y617C probably damaging Het
Amph G A 13: 19,326,198 (GRCm39) V643M probably damaging Het
Ano1 T G 7: 144,149,303 (GRCm39) S853R probably damaging Het
Ap4e1 T A 2: 126,853,743 (GRCm39) S60R possibly damaging Het
Atp4b C A 8: 13,439,693 (GRCm39) K176N possibly damaging Het
Atxn2 A T 5: 121,940,171 (GRCm39) D982V probably damaging Het
Atxn2 T C 5: 121,951,593 (GRCm39) F646S probably damaging Het
Bcl2l13 T C 6: 120,847,755 (GRCm39) C136R possibly damaging Het
Bltp1 C T 3: 37,106,684 (GRCm39) H5005Y unknown Het
Cacna1i A G 15: 80,275,975 (GRCm39) probably null Het
Ccdc122 T A 14: 77,305,379 (GRCm39) V11D possibly damaging Het
Cdnf A G 2: 3,522,078 (GRCm39) D90G probably damaging Het
Cep104 T G 4: 154,078,965 (GRCm39) V323G probably benign Het
Chmp6 A G 11: 119,807,541 (GRCm39) D128G probably benign Het
Clec18a A T 8: 111,805,498 (GRCm39) M201K probably benign Het
Col11a1 A T 3: 114,010,644 (GRCm39) probably benign Het
Col6a4 A T 9: 105,952,419 (GRCm39) M493K probably damaging Het
Crygd A C 1: 65,102,216 (GRCm39) probably null Het
Dennd1c T C 17: 57,373,935 (GRCm39) T543A probably benign Het
Erbb4 A T 1: 68,117,741 (GRCm39) C891* probably null Het
Ercc5 A T 1: 44,217,401 (GRCm39) K915* probably null Het
Ercc6 A T 14: 32,240,979 (GRCm39) N168Y probably damaging Het
Esrp2 G T 8: 106,863,384 (GRCm39) P6T unknown Het
Exoc1 A G 5: 76,697,411 (GRCm39) K396R possibly damaging Het
Fat3 T A 9: 15,836,387 (GRCm39) Y4039F probably benign Het
Fcsk A T 8: 111,609,873 (GRCm39) L1047Q probably damaging Het
Fgf7 T A 2: 125,877,738 (GRCm39) M35K probably damaging Het
Fras1 G A 5: 96,784,678 (GRCm39) G887D probably damaging Het
Gbp4 A T 5: 105,269,658 (GRCm39) probably null Het
Homez A T 14: 55,095,162 (GRCm39) M182K probably benign Het
Hrnr G A 3: 93,230,101 (GRCm39) S113N possibly damaging Het
Ifit3b T G 19: 34,589,072 (GRCm39) S83A probably benign Het
Ildr2 A G 1: 166,098,064 (GRCm39) probably null Het
Klhdc1 A T 12: 69,309,972 (GRCm39) R291S probably benign Het
Krt77 T A 15: 101,769,523 (GRCm39) I413F probably damaging Het
Lipn A G 19: 34,046,070 (GRCm39) I14M probably damaging Het
Macf1 T G 4: 123,369,807 (GRCm39) R86S probably benign Het
Mroh8 C A 2: 157,071,975 (GRCm39) G510V probably damaging Het
Mycbp2 A T 14: 103,470,033 (GRCm39) D1255E possibly damaging Het
Nckap5 C T 1: 125,952,659 (GRCm39) V1234I possibly damaging Het
Nlrp9c T C 7: 26,081,723 (GRCm39) K668E probably damaging Het
Nod2 T C 8: 89,391,217 (GRCm39) M508T possibly damaging Het
Npffr1 A G 10: 61,450,016 (GRCm39) M97V possibly damaging Het
Nsd3 G A 8: 26,188,795 (GRCm39) V43M probably damaging Het
Nubp2 A G 17: 25,103,388 (GRCm39) V163A probably damaging Het
Oas1e A T 5: 120,926,054 (GRCm39) F338Y probably damaging Het
Oat C A 7: 132,165,998 (GRCm39) G196C probably damaging Het
Or4a69 C T 2: 89,312,897 (GRCm39) G194D probably damaging Het
Or52e8b A T 7: 104,673,971 (GRCm39) L72Q probably damaging Het
Or7a41 T C 10: 78,871,398 (GRCm39) L256P probably damaging Het
P2ry13 T C 3: 59,117,710 (GRCm39) T23A probably benign Het
Phf8-ps A G 17: 33,286,215 (GRCm39) S196P probably damaging Het
Pja2 C A 17: 64,616,217 (GRCm39) S226I possibly damaging Het
Pkhd1l1 T C 15: 44,390,120 (GRCm39) V1412A probably damaging Het
Plekhs1 T C 19: 56,468,427 (GRCm39) S332P probably damaging Het
Polr3e T A 7: 120,539,820 (GRCm39) N522K probably damaging Het
Prdm10 A G 9: 31,268,582 (GRCm39) T844A probably damaging Het
Ripk1 C T 13: 34,212,130 (GRCm39) P480L probably benign Het
Rnf139 T C 15: 58,771,064 (GRCm39) V363A probably damaging Het
Rnf19a A T 15: 36,265,801 (GRCm39) S99T possibly damaging Het
Rnf224 G A 2: 25,126,110 (GRCm39) T81I probably benign Het
Rpgrip1 T C 14: 52,349,681 (GRCm39) L23S probably benign Het
Setd5 T A 6: 113,098,699 (GRCm39) F758L probably damaging Het
Smlr1 C A 10: 25,411,976 (GRCm39) V4L possibly damaging Het
Snx1 T C 9: 66,016,825 (GRCm39) D34G probably damaging Het
Spaca5 A T X: 20,942,892 (GRCm39) T92S probably benign Het
Speer4f2 A G 5: 17,581,540 (GRCm39) T161A Het
Swi5 C A 2: 32,170,716 (GRCm39) probably null Het
Syne2 T A 12: 76,012,874 (GRCm39) D2689E probably benign Het
Tcof1 T A 18: 60,948,071 (GRCm39) K1299* probably null Het
Tmprss11e G A 5: 86,872,069 (GRCm39) T49I probably damaging Het
Tmx3 T A 18: 90,555,210 (GRCm39) V309D possibly damaging Het
Trim30b C G 7: 104,006,506 (GRCm39) V117L possibly damaging Het
Tsen2 C A 6: 115,536,989 (GRCm39) H248Q probably benign Het
Ttn T C 2: 76,567,412 (GRCm39) Y19500C probably damaging Het
Tubgcp2 A G 7: 139,613,696 (GRCm39) probably benign Het
Wfdc2 A G 2: 164,407,828 (GRCm39) K166E probably damaging Het
Xrcc2 T C 5: 25,897,292 (GRCm39) D219G probably benign Het
Zc3h6 C T 2: 128,858,989 (GRCm39) P1007S probably benign Het
Zdhhc17 A T 10: 110,784,050 (GRCm39) probably null Het
Zfp369 T A 13: 65,439,979 (GRCm39) I221N probably damaging Het
Zfp655 A T 5: 145,181,411 (GRCm39) N423I probably damaging Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125,635,835 (GRCm39) missense unknown
IGL00561:Vwf APN 6 125,619,684 (GRCm39) missense possibly damaging 0.88
IGL01104:Vwf APN 6 125,660,519 (GRCm39) missense probably damaging 1.00
IGL01404:Vwf APN 6 125,654,933 (GRCm39) missense probably damaging 1.00
IGL01539:Vwf APN 6 125,567,225 (GRCm39) missense possibly damaging 0.85
IGL01550:Vwf APN 6 125,656,252 (GRCm39) missense probably benign 0.00
IGL01563:Vwf APN 6 125,568,128 (GRCm39) missense probably damaging 1.00
IGL01637:Vwf APN 6 125,622,699 (GRCm39) missense probably damaging 1.00
IGL01720:Vwf APN 6 125,619,798 (GRCm39) missense possibly damaging 0.69
IGL01834:Vwf APN 6 125,567,133 (GRCm39) splice site probably benign
IGL02103:Vwf APN 6 125,623,318 (GRCm39) missense probably damaging 1.00
IGL02120:Vwf APN 6 125,592,997 (GRCm39) missense probably benign 0.26
IGL02174:Vwf APN 6 125,532,358 (GRCm39) missense probably damaging 1.00
IGL02203:Vwf APN 6 125,619,369 (GRCm39) missense probably damaging 1.00
IGL02420:Vwf APN 6 125,654,879 (GRCm39) missense probably benign 0.00
IGL02723:Vwf APN 6 125,619,893 (GRCm39) missense possibly damaging 0.85
IGL02818:Vwf APN 6 125,640,511 (GRCm39) missense probably benign
IGL02931:Vwf APN 6 125,592,931 (GRCm39) missense possibly damaging 0.68
IGL03015:Vwf APN 6 125,661,101 (GRCm39) splice site probably benign
IGL03038:Vwf APN 6 125,581,120 (GRCm39) missense possibly damaging 0.92
IGL03060:Vwf APN 6 125,640,523 (GRCm39) missense probably damaging 1.00
IGL03114:Vwf APN 6 125,576,326 (GRCm39) nonsense probably null
IGL03266:Vwf APN 6 125,655,040 (GRCm39) splice site probably benign
gingerman UTSW 6 125,639,926 (GRCm39) critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125,662,800 (GRCm39) missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125,640,534 (GRCm39) nonsense probably null
R1628_Vwf_608 UTSW 6 125,624,701 (GRCm39) unclassified probably benign
R1669_Vwf_448 UTSW 6 125,624,869 (GRCm39) missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125,619,000 (GRCm39) missense probably benign 0.14
R2130_vwf_946 UTSW 6 125,634,020 (GRCm39) missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125,660,489 (GRCm39) missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125,605,439 (GRCm39) critical splice donor site probably null
Russiahouse UTSW 6 125,616,304 (GRCm39) nonsense probably null
B5639:Vwf UTSW 6 125,619,947 (GRCm39) missense probably damaging 1.00
R0025:Vwf UTSW 6 125,659,775 (GRCm39) missense probably benign 0.05
R0025:Vwf UTSW 6 125,659,775 (GRCm39) missense probably benign 0.05
R0087:Vwf UTSW 6 125,622,917 (GRCm39) missense probably benign 0.03
R0194:Vwf UTSW 6 125,620,260 (GRCm39) missense probably benign
R0206:Vwf UTSW 6 125,614,419 (GRCm39) missense probably damaging 1.00
R0233:Vwf UTSW 6 125,663,473 (GRCm39) missense possibly damaging 0.91
R0233:Vwf UTSW 6 125,663,473 (GRCm39) missense possibly damaging 0.91
R0390:Vwf UTSW 6 125,603,324 (GRCm39) nonsense probably null
R0427:Vwf UTSW 6 125,650,902 (GRCm39) missense probably benign
R0437:Vwf UTSW 6 125,543,281 (GRCm39) missense probably damaging 1.00
R0470:Vwf UTSW 6 125,605,391 (GRCm39) missense possibly damaging 0.70
R0499:Vwf UTSW 6 125,615,077 (GRCm39) missense probably benign 0.10
R0554:Vwf UTSW 6 125,619,744 (GRCm39) missense probably benign 0.13
R0605:Vwf UTSW 6 125,662,800 (GRCm39) missense probably benign 0.02
R0711:Vwf UTSW 6 125,603,234 (GRCm39) missense probably benign 0.01
R0723:Vwf UTSW 6 125,543,225 (GRCm39) missense probably benign 0.01
R0973:Vwf UTSW 6 125,619,969 (GRCm39) missense probably damaging 1.00
R1054:Vwf UTSW 6 125,567,190 (GRCm39) missense probably damaging 1.00
R1115:Vwf UTSW 6 125,632,028 (GRCm39) missense unknown
R1156:Vwf UTSW 6 125,614,451 (GRCm39) missense probably damaging 1.00
R1191:Vwf UTSW 6 125,576,215 (GRCm39) missense probably damaging 1.00
R1240:Vwf UTSW 6 125,580,271 (GRCm39) splice site probably null
R1398:Vwf UTSW 6 125,580,420 (GRCm39) missense probably benign 0.02
R1435:Vwf UTSW 6 125,619,212 (GRCm39) nonsense probably null
R1575:Vwf UTSW 6 125,640,534 (GRCm39) nonsense probably null
R1575:Vwf UTSW 6 125,632,214 (GRCm39) missense unknown
R1628:Vwf UTSW 6 125,624,701 (GRCm39) unclassified probably benign
R1669:Vwf UTSW 6 125,624,869 (GRCm39) missense possibly damaging 0.92
R1699:Vwf UTSW 6 125,662,863 (GRCm39) missense possibly damaging 0.74
R1699:Vwf UTSW 6 125,620,032 (GRCm39) missense probably damaging 1.00
R1725:Vwf UTSW 6 125,623,245 (GRCm39) missense probably benign 0.05
R1742:Vwf UTSW 6 125,644,513 (GRCm39) missense probably benign 0.02
R1809:Vwf UTSW 6 125,567,138 (GRCm39) splice site probably benign
R1833:Vwf UTSW 6 125,619,000 (GRCm39) missense probably benign 0.14
R1866:Vwf UTSW 6 125,644,492 (GRCm39) missense possibly damaging 0.62
R1870:Vwf UTSW 6 125,619,902 (GRCm39) missense probably damaging 1.00
R1874:Vwf UTSW 6 125,605,335 (GRCm39) missense probably benign 0.00
R1941:Vwf UTSW 6 125,616,242 (GRCm39) missense possibly damaging 0.64
R2061:Vwf UTSW 6 125,568,151 (GRCm39) missense probably damaging 0.98
R2103:Vwf UTSW 6 125,623,293 (GRCm39) missense probably benign 0.31
R2104:Vwf UTSW 6 125,623,293 (GRCm39) missense probably benign 0.31
R2130:Vwf UTSW 6 125,634,020 (GRCm39) missense probably damaging 1.00
R2159:Vwf UTSW 6 125,603,304 (GRCm39) missense probably damaging 0.99
R2178:Vwf UTSW 6 125,619,095 (GRCm39) missense possibly damaging 0.90
R2656:Vwf UTSW 6 125,532,324 (GRCm39) missense probably benign 0.00
R2913:Vwf UTSW 6 125,662,809 (GRCm39) missense probably benign 0.08
R2917:Vwf UTSW 6 125,585,106 (GRCm39) missense probably benign 0.07
R3726:Vwf UTSW 6 125,654,911 (GRCm39) utr 3 prime probably benign
R3735:Vwf UTSW 6 125,565,576 (GRCm39) missense probably damaging 1.00
R3774:Vwf UTSW 6 125,626,062 (GRCm39) splice site probably null
R3934:Vwf UTSW 6 125,532,462 (GRCm39) missense probably damaging 1.00
R4291:Vwf UTSW 6 125,619,285 (GRCm39) missense probably damaging 1.00
R4384:Vwf UTSW 6 125,632,079 (GRCm39) missense unknown
R4743:Vwf UTSW 6 125,661,054 (GRCm39) critical splice acceptor site probably null
R4760:Vwf UTSW 6 125,547,567 (GRCm39) missense probably damaging 1.00
R4776:Vwf UTSW 6 125,543,268 (GRCm39) missense possibly damaging 0.53
R4791:Vwf UTSW 6 125,620,326 (GRCm39) missense
R4871:Vwf UTSW 6 125,663,425 (GRCm39) missense probably benign 0.25
R4894:Vwf UTSW 6 125,622,897 (GRCm39) nonsense probably null
R4963:Vwf UTSW 6 125,644,446 (GRCm39) nonsense probably null
R5010:Vwf UTSW 6 125,543,220 (GRCm39) missense probably benign 0.15
R5289:Vwf UTSW 6 125,644,473 (GRCm39) utr 3 prime probably benign
R5512:Vwf UTSW 6 125,650,850 (GRCm39) utr 3 prime probably benign
R5523:Vwf UTSW 6 125,620,005 (GRCm39) missense
R5642:Vwf UTSW 6 125,580,381 (GRCm39) missense
R5860:Vwf UTSW 6 125,656,228 (GRCm39) utr 3 prime probably benign
R5860:Vwf UTSW 6 125,620,053 (GRCm39) missense
R5896:Vwf UTSW 6 125,655,725 (GRCm39) critical splice acceptor site probably null
R5926:Vwf UTSW 6 125,581,137 (GRCm39) missense probably damaging 1.00
R5976:Vwf UTSW 6 125,580,426 (GRCm39) missense
R6053:Vwf UTSW 6 125,577,628 (GRCm39) missense probably benign 0.21
R6151:Vwf UTSW 6 125,634,028 (GRCm39) missense unknown
R6179:Vwf UTSW 6 125,626,252 (GRCm39) missense unknown
R6181:Vwf UTSW 6 125,543,109 (GRCm39) missense probably damaging 0.98
R6234:Vwf UTSW 6 125,634,128 (GRCm39) missense unknown
R6360:Vwf UTSW 6 125,660,489 (GRCm39) missense probably benign 0.13
R6412:Vwf UTSW 6 125,656,279 (GRCm39) missense probably benign 0.00
R6464:Vwf UTSW 6 125,616,363 (GRCm39) critical splice donor site probably null
R6522:Vwf UTSW 6 125,639,926 (GRCm39) critical splice acceptor site probably null
R6766:Vwf UTSW 6 125,616,339 (GRCm39) missense unknown
R6856:Vwf UTSW 6 125,619,113 (GRCm39) nonsense probably null
R6877:Vwf UTSW 6 125,634,164 (GRCm39) missense possibly damaging 0.48
R6896:Vwf UTSW 6 125,543,157 (GRCm39) missense probably damaging 1.00
R7113:Vwf UTSW 6 125,632,007 (GRCm39) missense
R7287:Vwf UTSW 6 125,614,430 (GRCm39) missense
R7359:Vwf UTSW 6 125,543,220 (GRCm39) missense
R7509:Vwf UTSW 6 125,619,132 (GRCm39) missense
R7519:Vwf UTSW 6 125,644,506 (GRCm39) missense
R7545:Vwf UTSW 6 125,591,060 (GRCm39) missense
R7549:Vwf UTSW 6 125,603,230 (GRCm39) missense
R7593:Vwf UTSW 6 125,624,731 (GRCm39) missense
R7635:Vwf UTSW 6 125,659,697 (GRCm39) missense
R7793:Vwf UTSW 6 125,663,483 (GRCm39) missense
R7802:Vwf UTSW 6 125,643,640 (GRCm39) missense
R7824:Vwf UTSW 6 125,635,778 (GRCm39) missense
R7849:Vwf UTSW 6 125,633,766 (GRCm39) missense
R7900:Vwf UTSW 6 125,605,439 (GRCm39) critical splice donor site probably null
R7919:Vwf UTSW 6 125,624,822 (GRCm39) missense
R7966:Vwf UTSW 6 125,616,304 (GRCm39) nonsense probably null
R8101:Vwf UTSW 6 125,547,522 (GRCm39) nonsense probably null
R8162:Vwf UTSW 6 125,622,799 (GRCm39) splice site probably null
R8345:Vwf UTSW 6 125,656,265 (GRCm39) missense
R8853:Vwf UTSW 6 125,634,227 (GRCm39) missense
R9027:Vwf UTSW 6 125,643,626 (GRCm39) missense
R9065:Vwf UTSW 6 125,623,262 (GRCm39) missense
R9068:Vwf UTSW 6 125,625,792 (GRCm39) unclassified probably benign
R9128:Vwf UTSW 6 125,619,693 (GRCm39) missense
R9136:Vwf UTSW 6 125,576,356 (GRCm39) splice site probably benign
R9164:Vwf UTSW 6 125,542,806 (GRCm39) missense
R9177:Vwf UTSW 6 125,581,254 (GRCm39) missense
R9334:Vwf UTSW 6 125,654,909 (GRCm39) missense
R9508:Vwf UTSW 6 125,532,471 (GRCm39) missense
R9553:Vwf UTSW 6 125,577,662 (GRCm39) missense
R9660:Vwf UTSW 6 125,568,670 (GRCm39) missense possibly damaging 0.61
R9706:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9708:Vwf UTSW 6 125,634,053 (GRCm39) missense
R9712:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9714:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9728:Vwf UTSW 6 125,568,670 (GRCm39) missense possibly damaging 0.61
R9758:Vwf UTSW 6 125,603,230 (GRCm39) missense
X0021:Vwf UTSW 6 125,623,294 (GRCm39) missense probably damaging 1.00
X0065:Vwf UTSW 6 125,580,396 (GRCm39) missense probably null 0.05
Z1176:Vwf UTSW 6 125,580,271 (GRCm39) splice site probably null
Z1176:Vwf UTSW 6 125,568,194 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AATTCCTGCAACCTGACCTGCC -3'
(R):5'- TGGTGTCAACACTGTCCACATTCTC -3'

Sequencing Primer
(F):5'- ACCTGCCGCTCCCTCTC -3'
(R):5'- ATATGTAGCTCACCAGTCCCTG -3'
Posted On 2014-04-13