Mutagenetix > Incidental Mutation

Incidental Mutation 'R1529:Stat4'

166418

Institutional Source

Beutler Lab

Gene Symbol

Stat4

Ensembl Gene

ENSMUSG00000062939

Gene Name

signal transducer and activator of transcription 4

Synonyms

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.447) question?

Stock #

R1529 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

51987148-52107189 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52011793 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 4 (W4R)

Ref Sequence

ENSEMBL: ENSMUSP00000130713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000027277
AA Change: W4R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939
AA Change: W4R

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.73e-60	SMART
Pfam:STAT_alpha	140	314	2.2e-54	PFAM
Pfam:STAT_bind	316	562	4.7e-76	PFAM
SH2	571	681	9.07e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168302
AA Change: W4R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939
AA Change: W4R

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.73e-60	SMART
Pfam:STAT_alpha	137	314	8.2e-66	PFAM
Pfam:STAT_bind	316	563	3.3e-114	PFAM
SH2	571	681	9.07e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187053

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	G	A	17: 47,413,890	S102L	probably benign	Het
A430105I19Rik	T	A	2: 118,761,760		probably null	Het
Adam11	T	C	11: 102,775,113		probably null	Het
AI314180	T	C	4: 58,832,701		probably null	Het
Amd1	A	T	10: 40,290,505	M194K	probably benign	Het
Ap1b1	T	G	11: 5,039,547	F793C	probably damaging	Het
Arfgef3	G	A	10: 18,613,222	R1292*	probably null	Het
Arhgef5	C	A	6: 43,279,515	H1186N	probably damaging	Het
Atad1	A	G	19: 32,706,921	F26L	probably benign	Het
Atg2b	C	T	12: 105,661,133	V532I	probably benign	Het
Atp2b4	A	G	1: 133,717,988	F943L	probably damaging	Het
Atp7b	G	A	8: 22,028,724	L21F	possibly damaging	Het
Cenpf	A	T	1: 189,660,038	D532E	probably benign	Het
Ckmt2	A	T	13: 91,861,201	D202E	probably benign	Het
Crim1	A	C	17: 78,367,954	K864T	probably benign	Het
Ctnnd2	A	G	15: 30,887,121	R765G	possibly damaging	Het
Ddx10	T	A	9: 53,117,199	R802*	probably null	Het
Dnah7b	T	A	1: 46,177,281	F1152L	probably damaging	Het
Dsg1c	T	C	18: 20,282,023	L659P	probably damaging	Het
Dzank1	A	G	2: 144,482,188	F577L	probably benign	Het
Eci3	T	C	13: 34,956,920	D93G	probably benign	Het
Ep400	C	A	5: 110,739,445	V591L	probably benign	Het
Fam126b	A	T	1: 58,539,607	D261E	probably benign	Het
Fgd3	T	C	13: 49,266,694	N569S	probably benign	Het
Ghsr	T	A	3: 27,372,482	V229E	probably damaging	Het
Gm8298	T	C	3: 59,861,112	I21T	probably benign	Het
Gna15	T	A	10: 81,509,342	I230F	probably damaging	Het
Gnl2	A	G	4: 125,046,306	S324G	probably damaging	Het
Grid1	T	C	14: 35,309,293	V281A	probably benign	Het
Hebp2	G	A	10: 18,545,761	A12V	possibly damaging	Het
Hfm1	T	C	5: 106,853,123	D1254G	probably benign	Het
Hif3a	A	C	7: 17,042,639	S459A	probably benign	Het
Hnrnpl	T	A	7: 28,813,923	N149K	possibly damaging	Het
Hoxc10	A	T	15: 102,967,200	S115C	probably damaging	Het
Ifnab	T	C	4: 88,691,055	D58G	possibly damaging	Het
Itfg1	T	C	8: 85,810,614	T195A	probably benign	Het
Itpr3	T	A	17: 27,105,485		probably null	Het
Iws1	A	G	18: 32,080,281	D254G	probably benign	Het
Kl	C	A	5: 150,988,941	D718E	probably benign	Het
Lrit2	A	G	14: 37,068,827	I154M	probably benign	Het
Lrp2	T	C	2: 69,523,182	D578G	probably damaging	Het
Lss	T	G	10: 76,536,289	Y159*	probably null	Het
Mab21l1	C	A	3: 55,783,833	Y280*	probably null	Het
Maf	A	T	8: 115,693,170	S378T	probably benign	Het
Mast2	C	T	4: 116,430,519	V59I	probably benign	Het
Nisch	C	T	14: 31,180,938		probably benign	Het
Nova2	A	T	7: 18,957,554	N139Y	probably damaging	Het
Nup210	C	A	6: 91,036,376	D434Y	probably damaging	Het
Nvl	C	T	1: 181,109,159		probably null	Het
Olfr1049	A	T	2: 86,255,241	Y151N	probably damaging	Het
Olfr1087	A	G	2: 86,690,333	V214A	possibly damaging	Het
Olfr577	A	G	7: 102,973,879	Y38H	probably damaging	Het
Olfr657	A	G	7: 104,636,489	T272A	probably benign	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Pbx3	T	C	2: 34,204,859	Y255C	probably damaging	Het
Pcyt1a	G	A	16: 32,451,793	E27K	possibly damaging	Het
Pex6	A	T	17: 46,714,064	T348S	probably benign	Het
Phf21b	A	G	15: 84,797,396	I251T	probably damaging	Het
Pkd2l2	T	C	18: 34,430,702	I490T	probably damaging	Het
Pla2g12a	T	A	3: 129,878,885	L56Q	probably damaging	Het
Plk4	A	G	3: 40,806,536	T434A	probably benign	Het
Ptpn13	A	G	5: 103,564,132	N1632S	probably benign	Het
Rfpl4	C	T	7: 5,110,712	V151M	probably damaging	Het
Rpain	G	C	11: 70,974,915	E169Q	probably damaging	Het
Samd8	T	A	14: 21,775,159	V124D	possibly damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Slc12a1	C	T	2: 125,190,295	T622I	probably damaging	Het
Slc17a3	T	A	13: 23,845,445	V67D	probably damaging	Het
Slc41a3	G	T	6: 90,644,216	V387L	probably damaging	Het
Slitrk1	T	A	14: 108,913,277	M1L	probably benign	Het
Tas2r126	A	G	6: 42,434,568	T12A	probably benign	Het
Tbc1d24	A	G	17: 24,185,979	C64R	probably damaging	Het
Tcaf2	T	C	6: 42,629,506	S505G	probably benign	Het
Tiam2	T	C	17: 3,516,703	V1506A	probably benign	Het
Tmem9b	A	C	7: 109,736,949	S163A	probably benign	Het
Tmtc2	G	A	10: 105,303,658	S669L	probably damaging	Het
Tnpo3	A	T	6: 29,560,221	I641K	possibly damaging	Het
Ttn	C	T	2: 76,735,367	A28214T	probably damaging	Het
Utp11	G	A	4: 124,683,239	A113V	probably benign	Het
Utp20	G	A	10: 88,753,006	R2434C	probably damaging	Het
Vmn1r60	A	T	7: 5,544,903	I66N	probably benign	Het
Zeb2	T	C	2: 44,997,194	E572G	probably damaging	Het

Other mutations in Stat4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Stat4	APN	1	52102878	missense	probably damaging	1.00
IGL00482:Stat4	APN	1	52074697	missense	probably benign	0.05
IGL01395:Stat4	APN	1	52011874	missense	probably damaging	1.00
IGL01533:Stat4	APN	1	52098419	missense	probably damaging	1.00
IGL01943:Stat4	APN	1	52096855	missense	possibly damaging	0.94
IGL02114:Stat4	APN	1	52102865	missense	probably damaging	1.00
IGL02151:Stat4	APN	1	52013870	missense	probably damaging	0.99
IGL02601:Stat4	APN	1	52098415	missense	probably damaging	1.00
R0016:Stat4	UTSW	1	52068780	missense	probably benign	0.01
R0243:Stat4	UTSW	1	52011857	missense	probably benign	0.22
R0329:Stat4	UTSW	1	52090870	intron	probably benign
R0973:Stat4	UTSW	1	52096820	missense	probably damaging	0.99
R1144:Stat4	UTSW	1	52084129	splice site	probably benign
R1187:Stat4	UTSW	1	52076677	missense	probably damaging	1.00
R1331:Stat4	UTSW	1	52013927	missense	probably benign	0.20
R1401:Stat4	UTSW	1	52071947	splice site	probably benign
R1711:Stat4	UTSW	1	52106925	missense	probably damaging	1.00
R2213:Stat4	UTSW	1	52013855	missense	probably damaging	0.98
R3003:Stat4	UTSW	1	52102986	missense	probably damaging	1.00
R3683:Stat4	UTSW	1	52013822	missense	possibly damaging	0.89
R3789:Stat4	UTSW	1	52011796	missense	probably benign	0.07
R3919:Stat4	UTSW	1	52096822	missense	possibly damaging	0.62
R4320:Stat4	UTSW	1	52074707	missense	probably benign
R4373:Stat4	UTSW	1	52071941	critical splice donor site	probably null
R5024:Stat4	UTSW	1	52082570	missense	possibly damaging	0.80
R5103:Stat4	UTSW	1	52071895	missense	probably damaging	0.97
R5206:Stat4	UTSW	1	52105236	missense	probably damaging	0.99
R5944:Stat4	UTSW	1	52074739	missense	probably damaging	1.00
R5961:Stat4	UTSW	1	52065384	missense	possibly damaging	0.50
R6001:Stat4	UTSW	1	52096867	missense	probably damaging	0.96
R6161:Stat4	UTSW	1	52074677	missense	possibly damaging	0.94
R6262:Stat4	UTSW	1	52102201	missense	probably null	1.00
R6701:Stat4	UTSW	1	52102974	missense	probably damaging	1.00
R6767:Stat4	UTSW	1	52076583	missense	probably benign	0.00
R6989:Stat4	UTSW	1	52068815	missense	probably benign	0.09
R7507:Stat4	UTSW	1	52078574	missense	probably damaging	1.00
R7539:Stat4	UTSW	1	52071709	splice site	probably null
R7546:Stat4	UTSW	1	52098463	missense	probably damaging	0.98
R7616:Stat4	UTSW	1	52013878	nonsense	probably null
R7751:Stat4	UTSW	1	52082552	missense	possibly damaging	0.73
R8052:Stat4	UTSW	1	52079773	missense	probably damaging	1.00
R8311:Stat4	UTSW	1	52102916	missense	probably damaging	1.00
R8419:Stat4	UTSW	1	52098478	missense	possibly damaging	0.89
R8679:Stat4	UTSW	1	52079832	missense	probably null	1.00
R8699:Stat4	UTSW	1	52071937	missense	probably benign
R8738:Stat4	UTSW	1	52076552	missense	possibly damaging	0.95
R8921:Stat4	UTSW	1	52105733	missense	probably benign	0.39
R9013:Stat4	UTSW	1	52011798	missense	probably benign	0.00
R9237:Stat4	UTSW	1	52106914	missense	probably benign
R9729:Stat4	UTSW	1	52102603	missense	possibly damaging	0.94
R9767:Stat4	UTSW	1	52102494	missense	probably damaging	1.00
Z1177:Stat4	UTSW	1	52084099	nonsense	probably null
Z1177:Stat4	UTSW	1	52098485	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTTCTGTGCTAATCCCCGAGTCTA -3'
(R):5'- AGGACACAAATCATCTGCCCATCATTT -3'

Sequencing Primer
(F):5'- TGGGACTTCCTGAAACAGC -3'
(R):5'- AGATGCCGGATTTCCATAGG -3'

Posted On

2014-04-13