Incidental Mutation 'R1529:Arhgef5'
ID 166452
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor 5
Synonyms 2210412D05Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1529 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 43242578-43266254 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 43256449 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 1186 (H1186N)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably damaging
Transcript: ENSMUST00000031750
AA Change: H1186N

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: H1186N

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182752
Predicted Effect unknown
Transcript: ENSMUST00000182924
AA Change: H454N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203387
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 T C 3: 59,768,533 (GRCm39) I21T probably benign Het
Adam11 T C 11: 102,665,939 (GRCm39) probably null Het
Amd1 A T 10: 40,166,501 (GRCm39) M194K probably benign Het
Ap1b1 T G 11: 4,989,547 (GRCm39) F793C probably damaging Het
Arfgef3 G A 10: 18,488,970 (GRCm39) R1292* probably null Het
Atad1 A G 19: 32,684,321 (GRCm39) F26L probably benign Het
Atg2b C T 12: 105,627,392 (GRCm39) V532I probably benign Het
Atp2b4 A G 1: 133,645,726 (GRCm39) F943L probably damaging Het
Atp7b G A 8: 22,518,740 (GRCm39) L21F possibly damaging Het
Ccdc9b T A 2: 118,592,241 (GRCm39) probably null Het
Cenpf A T 1: 189,392,235 (GRCm39) D532E probably benign Het
Cimip3 G A 17: 47,724,815 (GRCm39) S102L probably benign Het
Ckmt2 A T 13: 92,009,320 (GRCm39) D202E probably benign Het
Crim1 A C 17: 78,675,383 (GRCm39) K864T probably benign Het
Ctnnd2 A G 15: 30,887,267 (GRCm39) R765G possibly damaging Het
Ddx10 T A 9: 53,028,499 (GRCm39) R802* probably null Het
Dnah7b T A 1: 46,216,441 (GRCm39) F1152L probably damaging Het
Dsg1c T C 18: 20,415,080 (GRCm39) L659P probably damaging Het
Dzank1 A G 2: 144,324,108 (GRCm39) F577L probably benign Het
Eci3 T C 13: 35,140,903 (GRCm39) D93G probably benign Het
Ecpas T C 4: 58,832,701 (GRCm39) probably null Het
Ep400 C A 5: 110,887,311 (GRCm39) V591L probably benign Het
Fgd3 T C 13: 49,420,170 (GRCm39) N569S probably benign Het
Ghsr T A 3: 27,426,631 (GRCm39) V229E probably damaging Het
Gna15 T A 10: 81,345,176 (GRCm39) I230F probably damaging Het
Gnl2 A G 4: 124,940,099 (GRCm39) S324G probably damaging Het
Grid1 T C 14: 35,031,250 (GRCm39) V281A probably benign Het
Hebp2 G A 10: 18,421,509 (GRCm39) A12V possibly damaging Het
Hfm1 T C 5: 107,000,989 (GRCm39) D1254G probably benign Het
Hif3a A C 7: 16,776,564 (GRCm39) S459A probably benign Het
Hnrnpl T A 7: 28,513,348 (GRCm39) N149K possibly damaging Het
Hoxc10 A T 15: 102,875,635 (GRCm39) S115C probably damaging Het
Hycc2 A T 1: 58,578,766 (GRCm39) D261E probably benign Het
Ifnab T C 4: 88,609,292 (GRCm39) D58G possibly damaging Het
Itfg1 T C 8: 86,537,243 (GRCm39) T195A probably benign Het
Itpr3 T A 17: 27,324,459 (GRCm39) probably null Het
Iws1 A G 18: 32,213,334 (GRCm39) D254G probably benign Het
Kl C A 5: 150,912,406 (GRCm39) D718E probably benign Het
Lrit2 A G 14: 36,790,784 (GRCm39) I154M probably benign Het
Lrp2 T C 2: 69,353,526 (GRCm39) D578G probably damaging Het
Lss T G 10: 76,372,123 (GRCm39) Y159* probably null Het
Mab21l1 C A 3: 55,691,254 (GRCm39) Y280* probably null Het
Maf A T 8: 116,419,909 (GRCm39) S378T probably benign Het
Mast2 C T 4: 116,287,716 (GRCm39) V59I probably benign Het
Nisch C T 14: 30,902,895 (GRCm39) probably benign Het
Nova2 A T 7: 18,691,479 (GRCm39) N139Y probably damaging Het
Nup210 C A 6: 91,013,358 (GRCm39) D434Y probably damaging Het
Nvl C T 1: 180,936,724 (GRCm39) probably null Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
Or51g2 A G 7: 102,623,086 (GRCm39) Y38H probably damaging Het
Or56b1 A G 7: 104,285,696 (GRCm39) T272A probably benign Het
Or8k18 A T 2: 86,085,585 (GRCm39) Y151N probably damaging Het
Or8k3b A G 2: 86,520,677 (GRCm39) V214A possibly damaging Het
Pbx3 T C 2: 34,094,871 (GRCm39) Y255C probably damaging Het
Pcyt1a G A 16: 32,270,611 (GRCm39) E27K possibly damaging Het
Pex6 A T 17: 47,024,990 (GRCm39) T348S probably benign Het
Phf21b A G 15: 84,681,597 (GRCm39) I251T probably damaging Het
Pkd2l2 T C 18: 34,563,755 (GRCm39) I490T probably damaging Het
Pla2g12a T A 3: 129,672,534 (GRCm39) L56Q probably damaging Het
Plk4 A G 3: 40,760,971 (GRCm39) T434A probably benign Het
Ptpn13 A G 5: 103,711,998 (GRCm39) N1632S probably benign Het
Rfpl4 C T 7: 5,113,711 (GRCm39) V151M probably damaging Het
Rpain G C 11: 70,865,741 (GRCm39) E169Q probably damaging Het
Samd8 T A 14: 21,825,227 (GRCm39) V124D possibly damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Slc12a1 C T 2: 125,032,215 (GRCm39) T622I probably damaging Het
Slc17a3 T A 13: 24,029,428 (GRCm39) V67D probably damaging Het
Slc41a3 G T 6: 90,621,198 (GRCm39) V387L probably damaging Het
Slitrk1 T A 14: 109,150,709 (GRCm39) M1L probably benign Het
Stat4 T C 1: 52,050,952 (GRCm39) W4R probably damaging Het
Tas2r126 A G 6: 42,411,502 (GRCm39) T12A probably benign Het
Tbc1d24 A G 17: 24,404,953 (GRCm39) C64R probably damaging Het
Tcaf2 T C 6: 42,606,440 (GRCm39) S505G probably benign Het
Tiam2 T C 17: 3,566,978 (GRCm39) V1506A probably benign Het
Tmem9b A C 7: 109,336,156 (GRCm39) S163A probably benign Het
Tmtc2 G A 10: 105,139,519 (GRCm39) S669L probably damaging Het
Tnpo3 A T 6: 29,560,220 (GRCm39) I641K possibly damaging Het
Ttn C T 2: 76,565,711 (GRCm39) A28214T probably damaging Het
Utp11 G A 4: 124,577,032 (GRCm39) A113V probably benign Het
Utp20 G A 10: 88,588,868 (GRCm39) R2434C probably damaging Het
Vmn1r60 A T 7: 5,547,902 (GRCm39) I66N probably benign Het
Zeb2 T C 2: 44,887,206 (GRCm39) E572G probably damaging Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43,257,203 (GRCm39) nonsense probably null
IGL01341:Arhgef5 APN 6 43,260,925 (GRCm39) missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43,250,962 (GRCm39) missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43,251,538 (GRCm39) missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43,249,345 (GRCm39) missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43,252,064 (GRCm39) missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43,260,916 (GRCm39) missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43,249,869 (GRCm39) nonsense probably null
IGL03292:Arhgef5 APN 6 43,257,180 (GRCm39) missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43,250,934 (GRCm39) missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43,257,585 (GRCm39) missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43,242,555 (GRCm39) splice site probably null
R0206:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43,250,330 (GRCm39) missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43,251,568 (GRCm39) missense probably damaging 0.99
R1532:Arhgef5 UTSW 6 43,250,337 (GRCm39) missense probably benign
R1663:Arhgef5 UTSW 6 43,253,899 (GRCm39) missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43,257,133 (GRCm39) missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43,265,616 (GRCm39) missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43,260,252 (GRCm39) missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43,251,354 (GRCm39) missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43,250,724 (GRCm39) missense probably benign
R4205:Arhgef5 UTSW 6 43,250,766 (GRCm39) missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43,251,027 (GRCm39) missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43,252,033 (GRCm39) missense probably benign
R4636:Arhgef5 UTSW 6 43,251,876 (GRCm39) missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43,260,117 (GRCm39) missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43,250,484 (GRCm39) missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43,250,148 (GRCm39) missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43,250,634 (GRCm39) missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43,242,614 (GRCm39) start gained probably benign
R5251:Arhgef5 UTSW 6 43,249,815 (GRCm39) missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43,249,273 (GRCm39) missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43,250,997 (GRCm39) missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43,252,874 (GRCm39) missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43,252,038 (GRCm39) missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43,252,068 (GRCm39) missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43,251,966 (GRCm39) missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43,251,895 (GRCm39) missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43,257,933 (GRCm39) missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43,250,232 (GRCm39) missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43,251,351 (GRCm39) missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43,252,276 (GRCm39) missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43,265,665 (GRCm39) missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43,252,142 (GRCm39) missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43,250,166 (GRCm39) nonsense probably null
R7358:Arhgef5 UTSW 6 43,256,507 (GRCm39) missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43,257,216 (GRCm39) missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43,257,605 (GRCm39) nonsense probably null
R7503:Arhgef5 UTSW 6 43,250,933 (GRCm39) missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43,250,728 (GRCm39) missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43,252,069 (GRCm39) nonsense probably null
R7950:Arhgef5 UTSW 6 43,250,859 (GRCm39) missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43,260,885 (GRCm39) missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43,257,579 (GRCm39) missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43,252,933 (GRCm39) critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43,264,558 (GRCm39) missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43,260,940 (GRCm39) missense
R9610:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43,251,736 (GRCm39) missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43,250,527 (GRCm39) missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43,256,407 (GRCm39) missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43,250,635 (GRCm39) missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43,249,342 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCGGTTGACATGATCCACCAG -3'
(R):5'- GCTGCAATCTCAATGGCTAAGCAC -3'

Sequencing Primer
(F):5'- CGAGATCCAGCACAGTCTATTTG -3'
(R):5'- TCAATGGCTAAGCACAGCAAG -3'
Posted On 2014-04-13