Mutagenetix > Incidental Mutation

Incidental Mutation 'R1529:Arhgef5'

166452

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1529 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 43279515 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 1186 (H1186N)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: H1186N

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: H1186N

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182752

Predicted Effect

unknown
Transcript: ENSMUST00000182924
AA Change: H454N

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183313

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	G	A	17: 47,413,890	S102L	probably benign	Het
A430105I19Rik	T	A	2: 118,761,760		probably null	Het
Adam11	T	C	11: 102,775,113		probably null	Het
AI314180	T	C	4: 58,832,701		probably null	Het
Amd1	A	T	10: 40,290,505	M194K	probably benign	Het
Ap1b1	T	G	11: 5,039,547	F793C	probably damaging	Het
Arfgef3	G	A	10: 18,613,222	R1292*	probably null	Het
Atad1	A	G	19: 32,706,921	F26L	probably benign	Het
Atg2b	C	T	12: 105,661,133	V532I	probably benign	Het
Atp2b4	A	G	1: 133,717,988	F943L	probably damaging	Het
Atp7b	G	A	8: 22,028,724	L21F	possibly damaging	Het
Cenpf	A	T	1: 189,660,038	D532E	probably benign	Het
Ckmt2	A	T	13: 91,861,201	D202E	probably benign	Het
Crim1	A	C	17: 78,367,954	K864T	probably benign	Het
Ctnnd2	A	G	15: 30,887,121	R765G	possibly damaging	Het
Ddx10	T	A	9: 53,117,199	R802*	probably null	Het
Dnah7b	T	A	1: 46,177,281	F1152L	probably damaging	Het
Dsg1c	T	C	18: 20,282,023	L659P	probably damaging	Het
Dzank1	A	G	2: 144,482,188	F577L	probably benign	Het
Eci3	T	C	13: 34,956,920	D93G	probably benign	Het
Ep400	C	A	5: 110,739,445	V591L	probably benign	Het
Fam126b	A	T	1: 58,539,607	D261E	probably benign	Het
Fgd3	T	C	13: 49,266,694	N569S	probably benign	Het
Ghsr	T	A	3: 27,372,482	V229E	probably damaging	Het
Gm8298	T	C	3: 59,861,112	I21T	probably benign	Het
Gna15	T	A	10: 81,509,342	I230F	probably damaging	Het
Gnl2	A	G	4: 125,046,306	S324G	probably damaging	Het
Grid1	T	C	14: 35,309,293	V281A	probably benign	Het
Hebp2	G	A	10: 18,545,761	A12V	possibly damaging	Het
Hfm1	T	C	5: 106,853,123	D1254G	probably benign	Het
Hif3a	A	C	7: 17,042,639	S459A	probably benign	Het
Hnrnpl	T	A	7: 28,813,923	N149K	possibly damaging	Het
Hoxc10	A	T	15: 102,967,200	S115C	probably damaging	Het
Ifnab	T	C	4: 88,691,055	D58G	possibly damaging	Het
Itfg1	T	C	8: 85,810,614	T195A	probably benign	Het
Itpr3	T	A	17: 27,105,485		probably null	Het
Iws1	A	G	18: 32,080,281	D254G	probably benign	Het
Kl	C	A	5: 150,988,941	D718E	probably benign	Het
Lrit2	A	G	14: 37,068,827	I154M	probably benign	Het
Lrp2	T	C	2: 69,523,182	D578G	probably damaging	Het
Lss	T	G	10: 76,536,289	Y159*	probably null	Het
Mab21l1	C	A	3: 55,783,833	Y280*	probably null	Het
Maf	A	T	8: 115,693,170	S378T	probably benign	Het
Mast2	C	T	4: 116,430,519	V59I	probably benign	Het
Nisch	C	T	14: 31,180,938		probably benign	Het
Nova2	A	T	7: 18,957,554	N139Y	probably damaging	Het
Nup210	C	A	6: 91,036,376	D434Y	probably damaging	Het
Nvl	C	T	1: 181,109,159		probably null	Het
Olfr1049	A	T	2: 86,255,241	Y151N	probably damaging	Het
Olfr1087	A	G	2: 86,690,333	V214A	possibly damaging	Het
Olfr577	A	G	7: 102,973,879	Y38H	probably damaging	Het
Olfr657	A	G	7: 104,636,489	T272A	probably benign	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Pbx3	T	C	2: 34,204,859	Y255C	probably damaging	Het
Pcyt1a	G	A	16: 32,451,793	E27K	possibly damaging	Het
Pex6	A	T	17: 46,714,064	T348S	probably benign	Het
Phf21b	A	G	15: 84,797,396	I251T	probably damaging	Het
Pkd2l2	T	C	18: 34,430,702	I490T	probably damaging	Het
Pla2g12a	T	A	3: 129,878,885	L56Q	probably damaging	Het
Plk4	A	G	3: 40,806,536	T434A	probably benign	Het
Ptpn13	A	G	5: 103,564,132	N1632S	probably benign	Het
Rfpl4	C	T	7: 5,110,712	V151M	probably damaging	Het
Rpain	G	C	11: 70,974,915	E169Q	probably damaging	Het
Samd8	T	A	14: 21,775,159	V124D	possibly damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Slc12a1	C	T	2: 125,190,295	T622I	probably damaging	Het
Slc17a3	T	A	13: 23,845,445	V67D	probably damaging	Het
Slc41a3	G	T	6: 90,644,216	V387L	probably damaging	Het
Slitrk1	T	A	14: 108,913,277	M1L	probably benign	Het
Stat4	T	C	1: 52,011,793	W4R	probably damaging	Het
Tas2r126	A	G	6: 42,434,568	T12A	probably benign	Het
Tbc1d24	A	G	17: 24,185,979	C64R	probably damaging	Het
Tcaf2	T	C	6: 42,629,506	S505G	probably benign	Het
Tiam2	T	C	17: 3,516,703	V1506A	probably benign	Het
Tmem9b	A	C	7: 109,736,949	S163A	probably benign	Het
Tmtc2	G	A	10: 105,303,658	S669L	probably damaging	Het
Tnpo3	A	T	6: 29,560,221	I641K	possibly damaging	Het
Ttn	C	T	2: 76,735,367	A28214T	probably damaging	Het
Utp11	G	A	4: 124,683,239	A113V	probably benign	Het
Utp20	G	A	10: 88,753,006	R2434C	probably damaging	Het
Vmn1r60	A	T	7: 5,544,903	I66N	probably benign	Het
Zeb2	T	C	2: 44,997,194	E572G	probably damaging	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGCGGTTGACATGATCCACCAG -3'
(R):5'- GCTGCAATCTCAATGGCTAAGCAC -3'

Sequencing Primer
(F):5'- CGAGATCCAGCACAGTCTATTTG -3'
(R):5'- TCAATGGCTAAGCACAGCAAG -3'

Posted On

2014-04-13