Incidental Mutation 'R1529:Atp7b'
ID 166466
Institutional Source Beutler Lab
Gene Symbol Atp7b
Ensembl Gene ENSMUSG00000006567
Gene Name ATPase, Cu++ transporting, beta polypeptide
Synonyms Atp7a, WND, Wilson protein
Accession Numbers
Essential gene? Possibly essential (E-score: 0.636) question?
Stock # R1529 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 22482801-22550321 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 22518740 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 21 (L21F)
Ref Sequence ENSEMBL: ENSMUSP00000106366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000110738]
AlphaFold Q64446
Predicted Effect probably benign
Transcript: ENSMUST00000006742
AA Change: L33F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: L33F

DomainStartEndE-ValueType
Pfam:HMA 71 132 8.8e-14 PFAM
Pfam:HMA 156 217 6.6e-13 PFAM
Pfam:HMA 271 329 7.4e-13 PFAM
Pfam:HMA 364 425 1.1e-10 PFAM
Pfam:HMA 493 554 2.3e-14 PFAM
Pfam:HMA 569 630 3.1e-15 PFAM
transmembrane domain 656 675 N/A INTRINSIC
Pfam:E1-E2_ATPase 770 1018 3.3e-60 PFAM
Pfam:Hydrolase 1023 1276 1.3e-67 PFAM
Pfam:HAD 1026 1273 4.6e-10 PFAM
Pfam:Hydrolase_3 1243 1308 5.1e-7 PFAM
transmembrane domain 1322 1344 N/A INTRINSIC
low complexity region 1353 1370 N/A INTRINSIC
low complexity region 1418 1437 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110738
AA Change: L21F

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: L21F

DomainStartEndE-ValueType
Pfam:HMA 59 120 1.2e-13 PFAM
Pfam:HMA 144 205 9.7e-12 PFAM
PDB:2AW0|A 259 314 6e-6 PDB
Pfam:HMA 378 439 1.6e-13 PFAM
Pfam:HMA 454 515 1.5e-15 PFAM
transmembrane domain 541 560 N/A INTRINSIC
Pfam:E1-E2_ATPase 656 904 4.6e-50 PFAM
Pfam:Hydrolase 908 1161 6.6e-76 PFAM
Pfam:HAD 911 1158 1.5e-15 PFAM
Pfam:Hydrolase_3 1128 1193 8.5e-7 PFAM
transmembrane domain 1207 1229 N/A INTRINSIC
low complexity region 1238 1255 N/A INTRINSIC
low complexity region 1303 1322 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 T C 3: 59,768,533 (GRCm39) I21T probably benign Het
Adam11 T C 11: 102,665,939 (GRCm39) probably null Het
Amd1 A T 10: 40,166,501 (GRCm39) M194K probably benign Het
Ap1b1 T G 11: 4,989,547 (GRCm39) F793C probably damaging Het
Arfgef3 G A 10: 18,488,970 (GRCm39) R1292* probably null Het
Arhgef5 C A 6: 43,256,449 (GRCm39) H1186N probably damaging Het
Atad1 A G 19: 32,684,321 (GRCm39) F26L probably benign Het
Atg2b C T 12: 105,627,392 (GRCm39) V532I probably benign Het
Atp2b4 A G 1: 133,645,726 (GRCm39) F943L probably damaging Het
Ccdc9b T A 2: 118,592,241 (GRCm39) probably null Het
Cenpf A T 1: 189,392,235 (GRCm39) D532E probably benign Het
Cimip3 G A 17: 47,724,815 (GRCm39) S102L probably benign Het
Ckmt2 A T 13: 92,009,320 (GRCm39) D202E probably benign Het
Crim1 A C 17: 78,675,383 (GRCm39) K864T probably benign Het
Ctnnd2 A G 15: 30,887,267 (GRCm39) R765G possibly damaging Het
Ddx10 T A 9: 53,028,499 (GRCm39) R802* probably null Het
Dnah7b T A 1: 46,216,441 (GRCm39) F1152L probably damaging Het
Dsg1c T C 18: 20,415,080 (GRCm39) L659P probably damaging Het
Dzank1 A G 2: 144,324,108 (GRCm39) F577L probably benign Het
Eci3 T C 13: 35,140,903 (GRCm39) D93G probably benign Het
Ecpas T C 4: 58,832,701 (GRCm39) probably null Het
Ep400 C A 5: 110,887,311 (GRCm39) V591L probably benign Het
Fgd3 T C 13: 49,420,170 (GRCm39) N569S probably benign Het
Ghsr T A 3: 27,426,631 (GRCm39) V229E probably damaging Het
Gna15 T A 10: 81,345,176 (GRCm39) I230F probably damaging Het
Gnl2 A G 4: 124,940,099 (GRCm39) S324G probably damaging Het
Grid1 T C 14: 35,031,250 (GRCm39) V281A probably benign Het
Hebp2 G A 10: 18,421,509 (GRCm39) A12V possibly damaging Het
Hfm1 T C 5: 107,000,989 (GRCm39) D1254G probably benign Het
Hif3a A C 7: 16,776,564 (GRCm39) S459A probably benign Het
Hnrnpl T A 7: 28,513,348 (GRCm39) N149K possibly damaging Het
Hoxc10 A T 15: 102,875,635 (GRCm39) S115C probably damaging Het
Hycc2 A T 1: 58,578,766 (GRCm39) D261E probably benign Het
Ifnab T C 4: 88,609,292 (GRCm39) D58G possibly damaging Het
Itfg1 T C 8: 86,537,243 (GRCm39) T195A probably benign Het
Itpr3 T A 17: 27,324,459 (GRCm39) probably null Het
Iws1 A G 18: 32,213,334 (GRCm39) D254G probably benign Het
Kl C A 5: 150,912,406 (GRCm39) D718E probably benign Het
Lrit2 A G 14: 36,790,784 (GRCm39) I154M probably benign Het
Lrp2 T C 2: 69,353,526 (GRCm39) D578G probably damaging Het
Lss T G 10: 76,372,123 (GRCm39) Y159* probably null Het
Mab21l1 C A 3: 55,691,254 (GRCm39) Y280* probably null Het
Maf A T 8: 116,419,909 (GRCm39) S378T probably benign Het
Mast2 C T 4: 116,287,716 (GRCm39) V59I probably benign Het
Nisch C T 14: 30,902,895 (GRCm39) probably benign Het
Nova2 A T 7: 18,691,479 (GRCm39) N139Y probably damaging Het
Nup210 C A 6: 91,013,358 (GRCm39) D434Y probably damaging Het
Nvl C T 1: 180,936,724 (GRCm39) probably null Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
Or51g2 A G 7: 102,623,086 (GRCm39) Y38H probably damaging Het
Or56b1 A G 7: 104,285,696 (GRCm39) T272A probably benign Het
Or8k18 A T 2: 86,085,585 (GRCm39) Y151N probably damaging Het
Or8k3b A G 2: 86,520,677 (GRCm39) V214A possibly damaging Het
Pbx3 T C 2: 34,094,871 (GRCm39) Y255C probably damaging Het
Pcyt1a G A 16: 32,270,611 (GRCm39) E27K possibly damaging Het
Pex6 A T 17: 47,024,990 (GRCm39) T348S probably benign Het
Phf21b A G 15: 84,681,597 (GRCm39) I251T probably damaging Het
Pkd2l2 T C 18: 34,563,755 (GRCm39) I490T probably damaging Het
Pla2g12a T A 3: 129,672,534 (GRCm39) L56Q probably damaging Het
Plk4 A G 3: 40,760,971 (GRCm39) T434A probably benign Het
Ptpn13 A G 5: 103,711,998 (GRCm39) N1632S probably benign Het
Rfpl4 C T 7: 5,113,711 (GRCm39) V151M probably damaging Het
Rpain G C 11: 70,865,741 (GRCm39) E169Q probably damaging Het
Samd8 T A 14: 21,825,227 (GRCm39) V124D possibly damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Slc12a1 C T 2: 125,032,215 (GRCm39) T622I probably damaging Het
Slc17a3 T A 13: 24,029,428 (GRCm39) V67D probably damaging Het
Slc41a3 G T 6: 90,621,198 (GRCm39) V387L probably damaging Het
Slitrk1 T A 14: 109,150,709 (GRCm39) M1L probably benign Het
Stat4 T C 1: 52,050,952 (GRCm39) W4R probably damaging Het
Tas2r126 A G 6: 42,411,502 (GRCm39) T12A probably benign Het
Tbc1d24 A G 17: 24,404,953 (GRCm39) C64R probably damaging Het
Tcaf2 T C 6: 42,606,440 (GRCm39) S505G probably benign Het
Tiam2 T C 17: 3,566,978 (GRCm39) V1506A probably benign Het
Tmem9b A C 7: 109,336,156 (GRCm39) S163A probably benign Het
Tmtc2 G A 10: 105,139,519 (GRCm39) S669L probably damaging Het
Tnpo3 A T 6: 29,560,220 (GRCm39) I641K possibly damaging Het
Ttn C T 2: 76,565,711 (GRCm39) A28214T probably damaging Het
Utp11 G A 4: 124,577,032 (GRCm39) A113V probably benign Het
Utp20 G A 10: 88,588,868 (GRCm39) R2434C probably damaging Het
Vmn1r60 A T 7: 5,547,902 (GRCm39) I66N probably benign Het
Zeb2 T C 2: 44,887,206 (GRCm39) E572G probably damaging Het
Other mutations in Atp7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Atp7b APN 8 22,501,114 (GRCm39) missense possibly damaging 0.91
IGL00981:Atp7b APN 8 22,517,543 (GRCm39) splice site probably null
IGL01600:Atp7b APN 8 22,517,541 (GRCm39) splice site probably null
IGL01713:Atp7b APN 8 22,518,589 (GRCm39) missense probably damaging 1.00
IGL01778:Atp7b APN 8 22,484,844 (GRCm39) missense probably benign 0.42
IGL01926:Atp7b APN 8 22,501,797 (GRCm39) missense probably damaging 0.98
IGL02312:Atp7b APN 8 22,484,786 (GRCm39) missense probably damaging 0.99
IGL02562:Atp7b APN 8 22,518,101 (GRCm39) missense probably benign
IGL02573:Atp7b APN 8 22,512,486 (GRCm39) missense probably benign 0.00
IGL02603:Atp7b APN 8 22,484,792 (GRCm39) missense possibly damaging 0.88
IGL02622:Atp7b APN 8 22,518,454 (GRCm39) missense possibly damaging 0.69
IGL02721:Atp7b APN 8 22,512,493 (GRCm39) missense probably benign 0.00
IGL03145:Atp7b APN 8 22,508,159 (GRCm39) missense probably damaging 1.00
daffodil UTSW 8 22,488,282 (GRCm39) missense probably damaging 1.00
menace UTSW 8 22,512,381 (GRCm39) missense probably damaging 0.97
PIT4131001:Atp7b UTSW 8 22,484,672 (GRCm39) missense probably damaging 1.00
R0023:Atp7b UTSW 8 22,501,089 (GRCm39) missense probably damaging 1.00
R0046:Atp7b UTSW 8 22,550,011 (GRCm39) missense probably benign 0.00
R0128:Atp7b UTSW 8 22,518,188 (GRCm39) missense possibly damaging 0.47
R0130:Atp7b UTSW 8 22,518,188 (GRCm39) missense possibly damaging 0.47
R0325:Atp7b UTSW 8 22,518,467 (GRCm39) missense probably benign 0.22
R0412:Atp7b UTSW 8 22,485,675 (GRCm39) splice site probably null
R0856:Atp7b UTSW 8 22,487,647 (GRCm39) missense probably damaging 1.00
R0906:Atp7b UTSW 8 22,517,842 (GRCm39) missense probably benign
R0989:Atp7b UTSW 8 22,518,710 (GRCm39) missense possibly damaging 0.51
R1377:Atp7b UTSW 8 22,501,801 (GRCm39) missense probably benign 0.17
R1517:Atp7b UTSW 8 22,487,374 (GRCm39) missense probably damaging 1.00
R1521:Atp7b UTSW 8 22,517,689 (GRCm39) missense probably damaging 0.96
R1691:Atp7b UTSW 8 22,501,039 (GRCm39) missense possibly damaging 0.90
R1743:Atp7b UTSW 8 22,496,403 (GRCm39) missense probably damaging 1.00
R1815:Atp7b UTSW 8 22,501,667 (GRCm39) missense possibly damaging 0.80
R2008:Atp7b UTSW 8 22,517,996 (GRCm39) missense probably damaging 1.00
R2133:Atp7b UTSW 8 22,501,093 (GRCm39) missense probably damaging 1.00
R2155:Atp7b UTSW 8 22,503,600 (GRCm39) missense possibly damaging 0.69
R2182:Atp7b UTSW 8 22,504,563 (GRCm39) missense probably damaging 0.99
R2256:Atp7b UTSW 8 22,488,282 (GRCm39) missense probably damaging 1.00
R2257:Atp7b UTSW 8 22,488,282 (GRCm39) missense probably damaging 1.00
R2274:Atp7b UTSW 8 22,510,848 (GRCm39) missense probably benign 0.20
R2475:Atp7b UTSW 8 22,484,792 (GRCm39) missense possibly damaging 0.88
R2906:Atp7b UTSW 8 22,501,570 (GRCm39) missense probably damaging 1.00
R2907:Atp7b UTSW 8 22,501,570 (GRCm39) missense probably damaging 1.00
R3421:Atp7b UTSW 8 22,518,686 (GRCm39) missense probably damaging 1.00
R3422:Atp7b UTSW 8 22,518,686 (GRCm39) missense probably damaging 1.00
R3688:Atp7b UTSW 8 22,494,246 (GRCm39) missense probably damaging 1.00
R3945:Atp7b UTSW 8 22,510,880 (GRCm39) missense probably benign 0.02
R4235:Atp7b UTSW 8 22,501,039 (GRCm39) missense possibly damaging 0.90
R4700:Atp7b UTSW 8 22,490,137 (GRCm39) missense probably benign 0.00
R4701:Atp7b UTSW 8 22,490,137 (GRCm39) missense probably benign 0.00
R4877:Atp7b UTSW 8 22,518,617 (GRCm39) missense probably damaging 0.98
R4962:Atp7b UTSW 8 22,510,901 (GRCm39) missense probably damaging 1.00
R5009:Atp7b UTSW 8 22,517,714 (GRCm39) missense possibly damaging 0.88
R5016:Atp7b UTSW 8 22,505,885 (GRCm39) splice site probably null
R5038:Atp7b UTSW 8 22,518,472 (GRCm39) missense possibly damaging 0.67
R5438:Atp7b UTSW 8 22,504,570 (GRCm39) missense probably benign
R5467:Atp7b UTSW 8 22,501,570 (GRCm39) missense probably damaging 1.00
R5468:Atp7b UTSW 8 22,549,986 (GRCm39) critical splice donor site probably null
R5512:Atp7b UTSW 8 22,502,755 (GRCm39) missense probably benign 0.20
R5563:Atp7b UTSW 8 22,518,730 (GRCm39) missense possibly damaging 0.82
R5751:Atp7b UTSW 8 22,508,144 (GRCm39) missense probably damaging 1.00
R5773:Atp7b UTSW 8 22,517,879 (GRCm39) missense probably benign
R5941:Atp7b UTSW 8 22,487,512 (GRCm39) missense probably damaging 0.98
R6227:Atp7b UTSW 8 22,510,841 (GRCm39) missense possibly damaging 0.63
R6265:Atp7b UTSW 8 22,505,943 (GRCm39) nonsense probably null
R6290:Atp7b UTSW 8 22,510,836 (GRCm39) missense probably damaging 1.00
R6368:Atp7b UTSW 8 22,510,771 (GRCm39) splice site probably null
R6647:Atp7b UTSW 8 22,518,494 (GRCm39) missense probably damaging 1.00
R6788:Atp7b UTSW 8 22,494,391 (GRCm39) missense probably benign 0.37
R6830:Atp7b UTSW 8 22,512,381 (GRCm39) missense probably damaging 0.97
R6886:Atp7b UTSW 8 22,518,706 (GRCm39) missense probably benign 0.01
R6928:Atp7b UTSW 8 22,484,828 (GRCm39) missense probably benign
R6965:Atp7b UTSW 8 22,518,101 (GRCm39) missense probably benign
R7203:Atp7b UTSW 8 22,487,351 (GRCm39) missense probably damaging 1.00
R7222:Atp7b UTSW 8 22,512,394 (GRCm39) nonsense probably null
R7344:Atp7b UTSW 8 22,487,515 (GRCm39) missense probably damaging 1.00
R7384:Atp7b UTSW 8 22,512,331 (GRCm39) missense probably benign 0.01
R7449:Atp7b UTSW 8 22,501,865 (GRCm39) missense probably damaging 0.98
R7451:Atp7b UTSW 8 22,504,700 (GRCm39) nonsense probably null
R7607:Atp7b UTSW 8 22,501,522 (GRCm39) missense probably damaging 1.00
R8140:Atp7b UTSW 8 22,518,576 (GRCm39) missense probably damaging 1.00
R8160:Atp7b UTSW 8 22,487,575 (GRCm39) missense probably damaging 0.98
R8349:Atp7b UTSW 8 22,503,556 (GRCm39) missense probably damaging 1.00
R8421:Atp7b UTSW 8 22,518,487 (GRCm39) missense probably benign 0.01
R8449:Atp7b UTSW 8 22,503,556 (GRCm39) missense probably damaging 1.00
R8749:Atp7b UTSW 8 22,518,334 (GRCm39) missense probably damaging 0.96
R8989:Atp7b UTSW 8 22,510,911 (GRCm39) missense probably benign 0.06
R9210:Atp7b UTSW 8 22,487,406 (GRCm39) missense probably damaging 1.00
R9353:Atp7b UTSW 8 22,517,890 (GRCm39) missense possibly damaging 0.78
R9462:Atp7b UTSW 8 22,490,160 (GRCm39) missense probably damaging 0.99
R9485:Atp7b UTSW 8 22,502,778 (GRCm39) missense probably damaging 0.99
Z1176:Atp7b UTSW 8 22,518,730 (GRCm39) missense probably benign 0.07
Z1177:Atp7b UTSW 8 22,484,893 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGACGGCACATATCTGACAGTGG -3'
(R):5'- AGGAGTGGATACAGCTCAGCTCAAG -3'

Sequencing Primer
(F):5'- AGGGACACCTTGATGTTCAC -3'
(R):5'- TAAGATTTCTAAGCCCAGGGAC -3'
Posted On 2014-04-13