Incidental Mutation 'R1529:Arfgef3'
ID 166472
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene Name ARFGEF family member 3
Synonyms B930094H20Rik, D10Bwg1379e, BIG3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R1529 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 18581839-18743949 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 18613222 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1292 (R1292*)
Ref Sequence ENSEMBL: ENSMUSP00000149210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
AlphaFold Q3UGY8
Predicted Effect probably null
Transcript: ENSMUST00000019999
AA Change: R1292*
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: R1292*

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000215836
AA Change: R1292*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik G A 17: 47,413,890 S102L probably benign Het
A430105I19Rik T A 2: 118,761,760 probably null Het
Adam11 T C 11: 102,775,113 probably null Het
AI314180 T C 4: 58,832,701 probably null Het
Amd1 A T 10: 40,290,505 M194K probably benign Het
Ap1b1 T G 11: 5,039,547 F793C probably damaging Het
Arhgef5 C A 6: 43,279,515 H1186N probably damaging Het
Atad1 A G 19: 32,706,921 F26L probably benign Het
Atg2b C T 12: 105,661,133 V532I probably benign Het
Atp2b4 A G 1: 133,717,988 F943L probably damaging Het
Atp7b G A 8: 22,028,724 L21F possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Ckmt2 A T 13: 91,861,201 D202E probably benign Het
Crim1 A C 17: 78,367,954 K864T probably benign Het
Ctnnd2 A G 15: 30,887,121 R765G possibly damaging Het
Ddx10 T A 9: 53,117,199 R802* probably null Het
Dnah7b T A 1: 46,177,281 F1152L probably damaging Het
Dsg1c T C 18: 20,282,023 L659P probably damaging Het
Dzank1 A G 2: 144,482,188 F577L probably benign Het
Eci3 T C 13: 34,956,920 D93G probably benign Het
Ep400 C A 5: 110,739,445 V591L probably benign Het
Fam126b A T 1: 58,539,607 D261E probably benign Het
Fgd3 T C 13: 49,266,694 N569S probably benign Het
Ghsr T A 3: 27,372,482 V229E probably damaging Het
Gm8298 T C 3: 59,861,112 I21T probably benign Het
Gna15 T A 10: 81,509,342 I230F probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Grid1 T C 14: 35,309,293 V281A probably benign Het
Hebp2 G A 10: 18,545,761 A12V possibly damaging Het
Hfm1 T C 5: 106,853,123 D1254G probably benign Het
Hif3a A C 7: 17,042,639 S459A probably benign Het
Hnrnpl T A 7: 28,813,923 N149K possibly damaging Het
Hoxc10 A T 15: 102,967,200 S115C probably damaging Het
Ifnab T C 4: 88,691,055 D58G possibly damaging Het
Itfg1 T C 8: 85,810,614 T195A probably benign Het
Itpr3 T A 17: 27,105,485 probably null Het
Iws1 A G 18: 32,080,281 D254G probably benign Het
Kl C A 5: 150,988,941 D718E probably benign Het
Lrit2 A G 14: 37,068,827 I154M probably benign Het
Lrp2 T C 2: 69,523,182 D578G probably damaging Het
Lss T G 10: 76,536,289 Y159* probably null Het
Mab21l1 C A 3: 55,783,833 Y280* probably null Het
Maf A T 8: 115,693,170 S378T probably benign Het
Mast2 C T 4: 116,430,519 V59I probably benign Het
Nisch C T 14: 31,180,938 probably benign Het
Nova2 A T 7: 18,957,554 N139Y probably damaging Het
Nup210 C A 6: 91,036,376 D434Y probably damaging Het
Nvl C T 1: 181,109,159 probably null Het
Olfr1049 A T 2: 86,255,241 Y151N probably damaging Het
Olfr1087 A G 2: 86,690,333 V214A possibly damaging Het
Olfr577 A G 7: 102,973,879 Y38H probably damaging Het
Olfr657 A G 7: 104,636,489 T272A probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pbx3 T C 2: 34,204,859 Y255C probably damaging Het
Pcyt1a G A 16: 32,451,793 E27K possibly damaging Het
Pex6 A T 17: 46,714,064 T348S probably benign Het
Phf21b A G 15: 84,797,396 I251T probably damaging Het
Pkd2l2 T C 18: 34,430,702 I490T probably damaging Het
Pla2g12a T A 3: 129,878,885 L56Q probably damaging Het
Plk4 A G 3: 40,806,536 T434A probably benign Het
Ptpn13 A G 5: 103,564,132 N1632S probably benign Het
Rfpl4 C T 7: 5,110,712 V151M probably damaging Het
Rpain G C 11: 70,974,915 E169Q probably damaging Het
Samd8 T A 14: 21,775,159 V124D possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc12a1 C T 2: 125,190,295 T622I probably damaging Het
Slc17a3 T A 13: 23,845,445 V67D probably damaging Het
Slc41a3 G T 6: 90,644,216 V387L probably damaging Het
Slitrk1 T A 14: 108,913,277 M1L probably benign Het
Stat4 T C 1: 52,011,793 W4R probably damaging Het
Tas2r126 A G 6: 42,434,568 T12A probably benign Het
Tbc1d24 A G 17: 24,185,979 C64R probably damaging Het
Tcaf2 T C 6: 42,629,506 S505G probably benign Het
Tiam2 T C 17: 3,516,703 V1506A probably benign Het
Tmem9b A C 7: 109,736,949 S163A probably benign Het
Tmtc2 G A 10: 105,303,658 S669L probably damaging Het
Tnpo3 A T 6: 29,560,221 I641K possibly damaging Het
Ttn C T 2: 76,735,367 A28214T probably damaging Het
Utp11 G A 4: 124,683,239 A113V probably benign Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Vmn1r60 A T 7: 5,544,903 I66N probably benign Het
Zeb2 T C 2: 44,997,194 E572G probably damaging Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18660604 missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18661358 missense probably benign
IGL00961:Arfgef3 APN 10 18611237 missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18652706 missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18600560 missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18594912 missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18603419 missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18743615 missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18591347 missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18646539 missense probably benign
IGL02400:Arfgef3 APN 10 18646257 missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18661392 splice site probably benign
IGL02815:Arfgef3 APN 10 18652551 missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18613225 missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18600544 missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18591882 missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18664912 missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18600490 missense probably damaging 1.00
Bow-wow UTSW 10 18646730 nonsense probably null
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18597407 missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18599214 missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18592281 missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18613127 splice site probably benign
R0417:Arfgef3 UTSW 10 18603511 missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18677815 splice site probably benign
R0507:Arfgef3 UTSW 10 18591621 missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18599288 missense probably damaging 1.00
R0582:Arfgef3 UTSW 10 18611290 missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18597431 missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18589666 missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18589735 missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18592118 missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18591375 missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18597348 missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18646554 missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18630879 missense probably damaging 0.96
R1564:Arfgef3 UTSW 10 18591704 missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18625148 missense probably null 0.15
R1868:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18597356 missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18652763 missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18592245 missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18616953 missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18597787 missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18677866 missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3963:Arfgef3 UTSW 10 18592277 missense probably damaging 1.00
R4201:Arfgef3 UTSW 10 18619782 missense probably benign 0.01
R4241:Arfgef3 UTSW 10 18625164 missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R4395:Arfgef3 UTSW 10 18597709 missense probably damaging 1.00
R4455:Arfgef3 UTSW 10 18607675 missense probably benign 0.18
R4480:Arfgef3 UTSW 10 18600600 missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18608343 missense possibly damaging 0.95
R4589:Arfgef3 UTSW 10 18646199 missense probably damaging 1.00
R4635:Arfgef3 UTSW 10 18634855 missense probably damaging 1.00
R4776:Arfgef3 UTSW 10 18654247 missense probably benign
R4801:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18646637 missense probably benign
R4828:Arfgef3 UTSW 10 18652693 missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4918:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18592186 missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18630851 missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18589706 missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18600460 missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18611237 missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18647798 splice site probably null
R5832:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18607665 nonsense probably null
R6272:Arfgef3 UTSW 10 18646963 missense probably benign 0.00
R6302:Arfgef3 UTSW 10 18652841 missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18607665 nonsense probably null
R6495:Arfgef3 UTSW 10 18611202 critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18621155 missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18595019 missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18664889 critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18646730 nonsense probably null
R6941:Arfgef3 UTSW 10 18625455 missense possibly damaging 0.66
R7094:Arfgef3 UTSW 10 18646439 missense probably damaging 1.00
R7179:Arfgef3 UTSW 10 18599267 missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18646462 missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18625391 missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18630835 missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18630463 missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18646259 missense probably benign 0.05
R7527:Arfgef3 UTSW 10 18646629 missense probably benign
R7618:Arfgef3 UTSW 10 18646281 missense probably damaging 1.00
R7779:Arfgef3 UTSW 10 18595023 missense probably damaging 0.99
R7851:Arfgef3 UTSW 10 18592286 missense probably damaging 1.00
R8112:Arfgef3 UTSW 10 18652631 missense possibly damaging 0.96
R8133:Arfgef3 UTSW 10 18611203 critical splice donor site probably null
R8242:Arfgef3 UTSW 10 18630076 missense probably benign 0.25
R8369:Arfgef3 UTSW 10 18589729 missense probably benign 0.34
R8396:Arfgef3 UTSW 10 18652532 critical splice donor site probably null
R8553:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R8798:Arfgef3 UTSW 10 18647051 missense probably damaging 1.00
R8821:Arfgef3 UTSW 10 18652743 missense possibly damaging 0.95
R8831:Arfgef3 UTSW 10 18652743 missense possibly damaging 0.95
R8918:Arfgef3 UTSW 10 18635705 missense probably benign 0.01
R8929:Arfgef3 UTSW 10 18603455 missense probably damaging 1.00
R9001:Arfgef3 UTSW 10 18646728 missense probably benign 0.32
R9077:Arfgef3 UTSW 10 18625151 missense possibly damaging 0.81
R9258:Arfgef3 UTSW 10 18589639 missense probably damaging 1.00
R9267:Arfgef3 UTSW 10 18599280 missense probably damaging 1.00
R9358:Arfgef3 UTSW 10 18616880 missense probably damaging 1.00
R9388:Arfgef3 UTSW 10 18630129 missense probably benign 0.35
R9389:Arfgef3 UTSW 10 18603523 missense probably damaging 1.00
R9563:Arfgef3 UTSW 10 18646527 missense probably damaging 1.00
R9713:Arfgef3 UTSW 10 18652808 missense probably damaging 1.00
X0026:Arfgef3 UTSW 10 18652626 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18591437 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18608358 missense probably damaging 0.97
Z1176:Arfgef3 UTSW 10 18634852 missense probably benign 0.26
Z1177:Arfgef3 UTSW 10 18607776 missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18627628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGACAAAACATGGGCTGACAGTG -3'
(R):5'- GCGGGAAAGGACCTGAATCTATAATGC -3'

Sequencing Primer
(F):5'- AAACATGGGCTGACAGTGTTTTTC -3'
(R):5'- GGACCTGAATCTATAATGCATGGC -3'
Posted On 2014-04-13