Mutagenetix > Incidental Mutations

Incidental Mutation 'R1529:Ap1b1'

166479

Institutional Source

Beutler Lab

Gene Symbol

Ap1b1

Ensembl Gene

ENSMUSG00000009090

Gene Name

adaptor protein complex AP-1, beta 1 subunit

Synonyms

Adtb1, beta-prime adaptin

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.626) question?

Stock #

R1529 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4986824-5042791 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 5039547 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Cysteine at position 793 (F793C)

Ref Sequence

ENSEMBL: ENSMUSP00000105523 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009234] [ENSMUST00000101613] [ENSMUST00000109897]

Predicted Effect

probably damaging
Transcript: ENSMUST00000009234
AA Change: F820C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000009234
Gene: ENSMUSG00000009090
AA Change: F820C

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	1.5e-174	PFAM
Pfam:HEAT_2	88	157	3.2e-8	PFAM
Pfam:Cnd1	99	268	4.1e-41	PFAM
low complexity region	594	616	N/A	INTRINSIC
low complexity region	626	638	N/A	INTRINSIC
low complexity region	657	670	N/A	INTRINSIC
low complexity region	674	686	N/A	INTRINSIC
Alpha_adaptinC2	713	823	3.38e-18	SMART
B2-adapt-app_C	832	942	4.6e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000101613
AA Change: F800C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099134
Gene: ENSMUSG00000009090
AA Change: F800C

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	179	7.5e-61	PFAM
Pfam:HEAT_2	88	179	2e-9	PFAM
Pfam:Cnd1	99	176	2.4e-19	PFAM
Pfam:Cnd1	174	241	1.9e-10	PFAM
Pfam:Adaptin_N	176	507	3.8e-102	PFAM
low complexity region	567	589	N/A	INTRINSIC
low complexity region	599	611	N/A	INTRINSIC
low complexity region	630	642	N/A	INTRINSIC
low complexity region	654	666	N/A	INTRINSIC
Alpha_adaptinC2	693	803	3.38e-18	SMART
B2-adapt-app_C	812	922	4.6e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109897
AA Change: F793C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105523
Gene: ENSMUSG00000009090
AA Change: F793C

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	179	1.2e-60	PFAM
Pfam:HEAT_2	88	185	3.9e-10	PFAM
Pfam:Cnd1	99	175	5e-20	PFAM
Pfam:Cnd1	174	241	1.7e-7	PFAM
Pfam:Adaptin_N	176	507	4.9e-102	PFAM
low complexity region	567	589	N/A	INTRINSIC
low complexity region	599	611	N/A	INTRINSIC
low complexity region	630	643	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
Alpha_adaptinC2	686	796	3.38e-18	SMART
B2-adapt-app_C	805	915	4.6e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133007

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142325

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158009

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197692

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 1 is found at the cytoplasmic face of coated vesicles located at the Golgi complex, where it mediates both the recruitment of clathrin to the membrane and the recognition of sorting signals within the cytosolic tails of transmembrane receptors. This complex is a heterotetramer composed of two large, one medium, and one small adaptin subunit. The protein encoded by this gene serves as one of the large subunits of this complex and is a member of the adaptin protein family. This gene is a candidate meningioma gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	G	A	17: 47,413,890	S102L	probably benign	Het
A430105I19Rik	T	A	2: 118,761,760		probably null	Het
Adam11	T	C	11: 102,775,113		probably null	Het
AI314180	T	C	4: 58,832,701		probably null	Het
Amd1	A	T	10: 40,290,505	M194K	probably benign	Het
Arfgef3	G	A	10: 18,613,222	R1292*	probably null	Het
Arhgef5	C	A	6: 43,279,515	H1186N	probably damaging	Het
Atad1	A	G	19: 32,706,921	F26L	probably benign	Het
Atg2b	C	T	12: 105,661,133	V532I	probably benign	Het
Atp2b4	A	G	1: 133,717,988	F943L	probably damaging	Het
Atp7b	G	A	8: 22,028,724	L21F	possibly damaging	Het
Cenpf	A	T	1: 189,660,038	D532E	probably benign	Het
Ckmt2	A	T	13: 91,861,201	D202E	probably benign	Het
Crim1	A	C	17: 78,367,954	K864T	probably benign	Het
Ctnnd2	A	G	15: 30,887,121	R765G	possibly damaging	Het
Ddx10	T	A	9: 53,117,199	R802*	probably null	Het
Dnah7b	T	A	1: 46,177,281	F1152L	probably damaging	Het
Dsg1c	T	C	18: 20,282,023	L659P	probably damaging	Het
Dzank1	A	G	2: 144,482,188	F577L	probably benign	Het
Eci3	T	C	13: 34,956,920	D93G	probably benign	Het
Ep400	C	A	5: 110,739,445	V591L	probably benign	Het
Fam126b	A	T	1: 58,539,607	D261E	probably benign	Het
Fgd3	T	C	13: 49,266,694	N569S	probably benign	Het
Ghsr	T	A	3: 27,372,482	V229E	probably damaging	Het
Gm8298	T	C	3: 59,861,112	I21T	probably benign	Het
Gna15	T	A	10: 81,509,342	I230F	probably damaging	Het
Gnl2	A	G	4: 125,046,306	S324G	probably damaging	Het
Grid1	T	C	14: 35,309,293	V281A	probably benign	Het
Hebp2	G	A	10: 18,545,761	A12V	possibly damaging	Het
Hfm1	T	C	5: 106,853,123	D1254G	probably benign	Het
Hif3a	A	C	7: 17,042,639	S459A	probably benign	Het
Hnrnpl	T	A	7: 28,813,923	N149K	possibly damaging	Het
Hoxc10	A	T	15: 102,967,200	S115C	probably damaging	Het
Ifnab	T	C	4: 88,691,055	D58G	possibly damaging	Het
Itfg1	T	C	8: 85,810,614	T195A	probably benign	Het
Itpr3	T	A	17: 27,105,485		probably null	Het
Iws1	A	G	18: 32,080,281	D254G	probably benign	Het
Kl	C	A	5: 150,988,941	D718E	probably benign	Het
Lrit2	A	G	14: 37,068,827	I154M	probably benign	Het
Lrp2	T	C	2: 69,523,182	D578G	probably damaging	Het
Lss	T	G	10: 76,536,289	Y159*	probably null	Het
Mab21l1	C	A	3: 55,783,833	Y280*	probably null	Het
Maf	A	T	8: 115,693,170	S378T	probably benign	Het
Mast2	C	T	4: 116,430,519	V59I	probably benign	Het
Nisch	C	T	14: 31,180,938		probably benign	Het
Nova2	A	T	7: 18,957,554	N139Y	probably damaging	Het
Nup210	C	A	6: 91,036,376	D434Y	probably damaging	Het
Nvl	C	T	1: 181,109,159		probably null	Het
Olfr1049	A	T	2: 86,255,241	Y151N	probably damaging	Het
Olfr1087	A	G	2: 86,690,333	V214A	possibly damaging	Het
Olfr577	A	G	7: 102,973,879	Y38H	probably damaging	Het
Olfr657	A	G	7: 104,636,489	T272A	probably benign	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Pbx3	T	C	2: 34,204,859	Y255C	probably damaging	Het
Pcyt1a	G	A	16: 32,451,793	E27K	possibly damaging	Het
Pex6	A	T	17: 46,714,064	T348S	probably benign	Het
Phf21b	A	G	15: 84,797,396	I251T	probably damaging	Het
Pkd2l2	T	C	18: 34,430,702	I490T	probably damaging	Het
Pla2g12a	T	A	3: 129,878,885	L56Q	probably damaging	Het
Plk4	A	G	3: 40,806,536	T434A	probably benign	Het
Ptpn13	A	G	5: 103,564,132	N1632S	probably benign	Het
Rfpl4	C	T	7: 5,110,712	V151M	probably damaging	Het
Rpain	G	C	11: 70,974,915	E169Q	probably damaging	Het
Samd8	T	A	14: 21,775,159	V124D	possibly damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Slc12a1	C	T	2: 125,190,295	T622I	probably damaging	Het
Slc17a3	T	A	13: 23,845,445	V67D	probably damaging	Het
Slc41a3	G	T	6: 90,644,216	V387L	probably damaging	Het
Slitrk1	T	A	14: 108,913,277	M1L	probably benign	Het
Stat4	T	C	1: 52,011,793	W4R	probably damaging	Het
Tas2r126	A	G	6: 42,434,568	T12A	probably benign	Het
Tbc1d24	A	G	17: 24,185,979	C64R	probably damaging	Het
Tcaf2	T	C	6: 42,629,506	S505G	probably benign	Het
Tiam2	T	C	17: 3,516,703	V1506A	probably benign	Het
Tmem9b	A	C	7: 109,736,949	S163A	probably benign	Het
Tmtc2	G	A	10: 105,303,658	S669L	probably damaging	Het
Tnpo3	A	T	6: 29,560,221	I641K	possibly damaging	Het
Ttn	C	T	2: 76,735,367	A28214T	probably damaging	Het
Utp11	G	A	4: 124,683,239	A113V	probably benign	Het
Utp20	G	A	10: 88,753,006	R2434C	probably damaging	Het
Vmn1r60	A	T	7: 5,544,903	I66N	probably benign	Het
Zeb2	T	C	2: 44,997,194	E572G	probably damaging	Het

Other mutations in Ap1b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01759:Ap1b1	APN	11	5019433	missense	probably damaging	1.00
IGL01843:Ap1b1	APN	11	5039169	missense	probably damaging	1.00
IGL01981:Ap1b1	APN	11	5019336	missense	possibly damaging	0.84
IGL02055:Ap1b1	APN	11	5024452	nonsense	probably null
IGL02318:Ap1b1	APN	11	5019294	missense	probably benign	0.14
IGL02505:Ap1b1	APN	11	5031700	missense	probably benign	0.11
IGL02824:Ap1b1	APN	11	5033738	missense	possibly damaging	0.47
IGL02825:Ap1b1	APN	11	5033738	missense	possibly damaging	0.47
IGL02963:Ap1b1	APN	11	5033738	missense	possibly damaging	0.47
PIT4142001:Ap1b1	UTSW	11	5040360	missense	probably damaging	1.00
R0321:Ap1b1	UTSW	11	5032464	missense	probably benign
R0477:Ap1b1	UTSW	11	5031787	missense	probably benign	0.13
R0622:Ap1b1	UTSW	11	5037707	missense	probably damaging	0.96
R0831:Ap1b1	UTSW	11	5023092	splice site	probably benign
R1502:Ap1b1	UTSW	11	5040290	missense	probably benign
R2110:Ap1b1	UTSW	11	5015613	missense	probably damaging	0.99
R2112:Ap1b1	UTSW	11	5015613	missense	probably damaging	0.99
R2186:Ap1b1	UTSW	11	5015737	missense	possibly damaging	0.84
R2906:Ap1b1	UTSW	11	5031641	missense	probably damaging	1.00
R2907:Ap1b1	UTSW	11	5031641	missense	probably damaging	1.00
R2908:Ap1b1	UTSW	11	5031641	missense	probably damaging	1.00
R3154:Ap1b1	UTSW	11	5023135	missense	possibly damaging	0.95
R3611:Ap1b1	UTSW	11	5024427	missense	possibly damaging	0.87
R3805:Ap1b1	UTSW	11	5033225	intron	probably null
R4207:Ap1b1	UTSW	11	5031637	missense	probably damaging	0.96
R4660:Ap1b1	UTSW	11	5016760	missense	probably damaging	1.00
R4710:Ap1b1	UTSW	11	5031664	missense	probably damaging	0.97
R4826:Ap1b1	UTSW	11	5018043	missense	probably benign	0.11
R4914:Ap1b1	UTSW	11	5024400	missense	possibly damaging	0.73
R5086:Ap1b1	UTSW	11	5018020	missense	possibly damaging	0.83
R5249:Ap1b1	UTSW	11	5026364	missense	probably damaging	0.97
R6014:Ap1b1	UTSW	11	5019364	missense	possibly damaging	0.55
R6268:Ap1b1	UTSW	11	5019493	missense	probably damaging	1.00
R6388:Ap1b1	UTSW	11	5026319	missense	probably damaging	1.00
R6765:Ap1b1	UTSW	11	5019427	missense	probably damaging	1.00
R6913:Ap1b1	UTSW	11	5012972	missense	possibly damaging	0.84
R7012:Ap1b1	UTSW	11	5030963	missense	probably damaging	1.00
R7107:Ap1b1	UTSW	11	5039558	missense	probably benign	0.02
X0018:Ap1b1	UTSW	11	5009581	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACCCCATTTCTACCCAGTGTCAG -3'
(R):5'- TGAAGATCCCATCCTAAGGCCCAG -3'

Sequencing Primer
(F):5'- TCTTGGCTACAGGTGGAACC -3'
(R):5'- AGCTGTCCTGCTGACCC -3'

Posted On

2014-04-13