Incidental Mutation 'R1529:Ap1b1'
ID166479
Institutional Source Beutler Lab
Gene Symbol Ap1b1
Ensembl Gene ENSMUSG00000009090
Gene Nameadaptor protein complex AP-1, beta 1 subunit
SynonymsAdtb1, beta-prime adaptin
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.626) question?
Stock #R1529 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location4986824-5042791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 5039547 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 793 (F793C)
Ref Sequence ENSEMBL: ENSMUSP00000105523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009234] [ENSMUST00000101613] [ENSMUST00000109897]
Predicted Effect probably damaging
Transcript: ENSMUST00000009234
AA Change: F820C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009234
Gene: ENSMUSG00000009090
AA Change: F820C

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 1.5e-174 PFAM
Pfam:HEAT_2 88 157 3.2e-8 PFAM
Pfam:Cnd1 99 268 4.1e-41 PFAM
low complexity region 594 616 N/A INTRINSIC
low complexity region 626 638 N/A INTRINSIC
low complexity region 657 670 N/A INTRINSIC
low complexity region 674 686 N/A INTRINSIC
Alpha_adaptinC2 713 823 3.38e-18 SMART
B2-adapt-app_C 832 942 4.6e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101613
AA Change: F800C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099134
Gene: ENSMUSG00000009090
AA Change: F800C

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 7.5e-61 PFAM
Pfam:HEAT_2 88 179 2e-9 PFAM
Pfam:Cnd1 99 176 2.4e-19 PFAM
Pfam:Cnd1 174 241 1.9e-10 PFAM
Pfam:Adaptin_N 176 507 3.8e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 654 666 N/A INTRINSIC
Alpha_adaptinC2 693 803 3.38e-18 SMART
B2-adapt-app_C 812 922 4.6e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109897
AA Change: F793C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105523
Gene: ENSMUSG00000009090
AA Change: F793C

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 1.2e-60 PFAM
Pfam:HEAT_2 88 185 3.9e-10 PFAM
Pfam:Cnd1 99 175 5e-20 PFAM
Pfam:Cnd1 174 241 1.7e-7 PFAM
Pfam:Adaptin_N 176 507 4.9e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
Alpha_adaptinC2 686 796 3.38e-18 SMART
B2-adapt-app_C 805 915 4.6e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197692
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 1 is found at the cytoplasmic face of coated vesicles located at the Golgi complex, where it mediates both the recruitment of clathrin to the membrane and the recognition of sorting signals within the cytosolic tails of transmembrane receptors. This complex is a heterotetramer composed of two large, one medium, and one small adaptin subunit. The protein encoded by this gene serves as one of the large subunits of this complex and is a member of the adaptin protein family. This gene is a candidate meningioma gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik G A 17: 47,413,890 S102L probably benign Het
A430105I19Rik T A 2: 118,761,760 probably null Het
Adam11 T C 11: 102,775,113 probably null Het
AI314180 T C 4: 58,832,701 probably null Het
Amd1 A T 10: 40,290,505 M194K probably benign Het
Arfgef3 G A 10: 18,613,222 R1292* probably null Het
Arhgef5 C A 6: 43,279,515 H1186N probably damaging Het
Atad1 A G 19: 32,706,921 F26L probably benign Het
Atg2b C T 12: 105,661,133 V532I probably benign Het
Atp2b4 A G 1: 133,717,988 F943L probably damaging Het
Atp7b G A 8: 22,028,724 L21F possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Ckmt2 A T 13: 91,861,201 D202E probably benign Het
Crim1 A C 17: 78,367,954 K864T probably benign Het
Ctnnd2 A G 15: 30,887,121 R765G possibly damaging Het
Ddx10 T A 9: 53,117,199 R802* probably null Het
Dnah7b T A 1: 46,177,281 F1152L probably damaging Het
Dsg1c T C 18: 20,282,023 L659P probably damaging Het
Dzank1 A G 2: 144,482,188 F577L probably benign Het
Eci3 T C 13: 34,956,920 D93G probably benign Het
Ep400 C A 5: 110,739,445 V591L probably benign Het
Fam126b A T 1: 58,539,607 D261E probably benign Het
Fgd3 T C 13: 49,266,694 N569S probably benign Het
Ghsr T A 3: 27,372,482 V229E probably damaging Het
Gm8298 T C 3: 59,861,112 I21T probably benign Het
Gna15 T A 10: 81,509,342 I230F probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Grid1 T C 14: 35,309,293 V281A probably benign Het
Hebp2 G A 10: 18,545,761 A12V possibly damaging Het
Hfm1 T C 5: 106,853,123 D1254G probably benign Het
Hif3a A C 7: 17,042,639 S459A probably benign Het
Hnrnpl T A 7: 28,813,923 N149K possibly damaging Het
Hoxc10 A T 15: 102,967,200 S115C probably damaging Het
Ifnab T C 4: 88,691,055 D58G possibly damaging Het
Itfg1 T C 8: 85,810,614 T195A probably benign Het
Itpr3 T A 17: 27,105,485 probably null Het
Iws1 A G 18: 32,080,281 D254G probably benign Het
Kl C A 5: 150,988,941 D718E probably benign Het
Lrit2 A G 14: 37,068,827 I154M probably benign Het
Lrp2 T C 2: 69,523,182 D578G probably damaging Het
Lss T G 10: 76,536,289 Y159* probably null Het
Mab21l1 C A 3: 55,783,833 Y280* probably null Het
Maf A T 8: 115,693,170 S378T probably benign Het
Mast2 C T 4: 116,430,519 V59I probably benign Het
Nisch C T 14: 31,180,938 probably benign Het
Nova2 A T 7: 18,957,554 N139Y probably damaging Het
Nup210 C A 6: 91,036,376 D434Y probably damaging Het
Nvl C T 1: 181,109,159 probably null Het
Olfr1049 A T 2: 86,255,241 Y151N probably damaging Het
Olfr1087 A G 2: 86,690,333 V214A possibly damaging Het
Olfr577 A G 7: 102,973,879 Y38H probably damaging Het
Olfr657 A G 7: 104,636,489 T272A probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pbx3 T C 2: 34,204,859 Y255C probably damaging Het
Pcyt1a G A 16: 32,451,793 E27K possibly damaging Het
Pex6 A T 17: 46,714,064 T348S probably benign Het
Phf21b A G 15: 84,797,396 I251T probably damaging Het
Pkd2l2 T C 18: 34,430,702 I490T probably damaging Het
Pla2g12a T A 3: 129,878,885 L56Q probably damaging Het
Plk4 A G 3: 40,806,536 T434A probably benign Het
Ptpn13 A G 5: 103,564,132 N1632S probably benign Het
Rfpl4 C T 7: 5,110,712 V151M probably damaging Het
Rpain G C 11: 70,974,915 E169Q probably damaging Het
Samd8 T A 14: 21,775,159 V124D possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc12a1 C T 2: 125,190,295 T622I probably damaging Het
Slc17a3 T A 13: 23,845,445 V67D probably damaging Het
Slc41a3 G T 6: 90,644,216 V387L probably damaging Het
Slitrk1 T A 14: 108,913,277 M1L probably benign Het
Stat4 T C 1: 52,011,793 W4R probably damaging Het
Tas2r126 A G 6: 42,434,568 T12A probably benign Het
Tbc1d24 A G 17: 24,185,979 C64R probably damaging Het
Tcaf2 T C 6: 42,629,506 S505G probably benign Het
Tiam2 T C 17: 3,516,703 V1506A probably benign Het
Tmem9b A C 7: 109,736,949 S163A probably benign Het
Tmtc2 G A 10: 105,303,658 S669L probably damaging Het
Tnpo3 A T 6: 29,560,221 I641K possibly damaging Het
Ttn C T 2: 76,735,367 A28214T probably damaging Het
Utp11 G A 4: 124,683,239 A113V probably benign Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Vmn1r60 A T 7: 5,544,903 I66N probably benign Het
Zeb2 T C 2: 44,997,194 E572G probably damaging Het
Other mutations in Ap1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Ap1b1 APN 11 5019433 missense probably damaging 1.00
IGL01843:Ap1b1 APN 11 5039169 missense probably damaging 1.00
IGL01981:Ap1b1 APN 11 5019336 missense possibly damaging 0.84
IGL02055:Ap1b1 APN 11 5024452 nonsense probably null
IGL02318:Ap1b1 APN 11 5019294 missense probably benign 0.14
IGL02505:Ap1b1 APN 11 5031700 missense probably benign 0.11
IGL02824:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
IGL02825:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
IGL02963:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
PIT4142001:Ap1b1 UTSW 11 5040360 missense probably damaging 1.00
R0321:Ap1b1 UTSW 11 5032464 missense probably benign
R0477:Ap1b1 UTSW 11 5031787 missense probably benign 0.13
R0622:Ap1b1 UTSW 11 5037707 missense probably damaging 0.96
R0831:Ap1b1 UTSW 11 5023092 splice site probably benign
R1502:Ap1b1 UTSW 11 5040290 missense probably benign
R2110:Ap1b1 UTSW 11 5015613 missense probably damaging 0.99
R2112:Ap1b1 UTSW 11 5015613 missense probably damaging 0.99
R2186:Ap1b1 UTSW 11 5015737 missense possibly damaging 0.84
R2906:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R2907:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R2908:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R3154:Ap1b1 UTSW 11 5023135 missense possibly damaging 0.95
R3611:Ap1b1 UTSW 11 5024427 missense possibly damaging 0.87
R3805:Ap1b1 UTSW 11 5033225 intron probably null
R4207:Ap1b1 UTSW 11 5031637 missense probably damaging 0.96
R4660:Ap1b1 UTSW 11 5016760 missense probably damaging 1.00
R4710:Ap1b1 UTSW 11 5031664 missense probably damaging 0.97
R4826:Ap1b1 UTSW 11 5018043 missense probably benign 0.11
R4914:Ap1b1 UTSW 11 5024400 missense possibly damaging 0.73
R5086:Ap1b1 UTSW 11 5018020 missense possibly damaging 0.83
R5249:Ap1b1 UTSW 11 5026364 missense probably damaging 0.97
R6014:Ap1b1 UTSW 11 5019364 missense possibly damaging 0.55
R6268:Ap1b1 UTSW 11 5019493 missense probably damaging 1.00
R6388:Ap1b1 UTSW 11 5026319 missense probably damaging 1.00
R6765:Ap1b1 UTSW 11 5019427 missense probably damaging 1.00
R6913:Ap1b1 UTSW 11 5012972 missense possibly damaging 0.84
R7012:Ap1b1 UTSW 11 5030963 missense probably damaging 1.00
R7107:Ap1b1 UTSW 11 5039558 missense probably benign 0.02
X0018:Ap1b1 UTSW 11 5009581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCCCATTTCTACCCAGTGTCAG -3'
(R):5'- TGAAGATCCCATCCTAAGGCCCAG -3'

Sequencing Primer
(F):5'- TCTTGGCTACAGGTGGAACC -3'
(R):5'- AGCTGTCCTGCTGACCC -3'
Posted On2014-04-13